Free Republic
Browse · Search
News/Activism
Topics · Post Article

How long until this happens here?
1 posted on 07/01/2015 2:19:30 PM PDT by nickcarraway
[ Post Reply | Private Reply | View Replies ]


To: nickcarraway

That’ll come in handy next time they’re scraping body parts off the walls.


2 posted on 07/01/2015 2:23:51 PM PDT by moovova
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway
Makes going after the family members of a suicide bomber easier.

Socialist DemoRats don't need DNA to do that here, now, when someone moneybombs a republican or conservative.

3 posted on 07/01/2015 2:35:13 PM PDT by Navy Patriot (America, a Rule of Mob nation)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

Suspect you’re right to ask that seeing the direction we’re heading in.
No need to fear, however. What could go wrong with a national DNA database and corrupt federal bureau of investigation?

http://reason.com/blog/2014/07/30/huge-scandal-at-fbi-dubious-forensic-evi

DNA scandal affects thousands of cases.


5 posted on 07/01/2015 2:41:44 PM PDT by MarchonDC09122009 (When is our next march on DC? When have we had enough?)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway

Hussein is taking notes.


8 posted on 07/01/2015 3:43:19 PM PDT by bgill ( CDC site, "we still do not know exactly how people are infected with Ebola")
[ Post Reply | Private Reply | To 1 | View Replies ]

To: nickcarraway; SunkenCiv; nuconvert

That is only post-mortem investigation, better to forbid the use of a burka, hijab etc. Learn from Chad http://gulfnews.com/news/africa/chad-s-ban-on-veil-after-attacks-divides-muslims-1.1538326

http://www.telegraph.co.uk/news/uknews/terrorism-in-the-uk/10438195/The-runaway-terrorist-his-burka-disguise-and-a-compensation-bid.html

http://www.danielpipes.org/blog/2002/03/niqabs-and-burqas-as-security-threats


9 posted on 07/03/2015 7:57:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson