Free Republic
Browse · Search
General/Chat
Topics · Post Article


AP/Bob Goldstein/Vicki Madden
1 posted on 11/25/2015 9:32:36 PM PST by BenLurkin
[ Post Reply | Private Reply | View Replies ]


To: BenLurkin

look it’s Michael Moore’s as a baby... aww how cute


2 posted on 11/25/2015 9:40:48 PM PST by tophat9000 (King G(OP)eorge III has no idea why the Americans Patriots are in rebellion... teach him why)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Saw this article in the news yesterday.
These creatures have Amazing survival capabilities, like no other living thing.
These Extremophiles are technically capable of living forever if allowed to go thru regular dormancy cycles.


3 posted on 11/25/2015 9:45:55 PM PST by MarchonDC09122009 (When is our next march on DC? When have we had enough?)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Darksheare; BenLurkin; Salamander
And the BLatting OG says:

"Mommy?!?"

4 posted on 11/25/2015 9:58:42 PM PST by shibumi (Vampire Outlaw of the Milky Way)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

5 posted on 11/25/2015 10:04:30 PM PST by Ken H
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

[[Through a process called horizontal gene transfer, any organism can theoretically swap genes with another.]]

Which only, according to my understanding, happens between the same kinds of species- not between unrelated species kinds because unrelated species kinds have several layers of protectiosn which prevent such horizontal transfers whereas related species kinds have the necessary info to receive and utilize dna from their own kind


9 posted on 11/25/2015 10:24:37 PM PST by Bob434
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Headline made me laugh.


12 posted on 11/25/2015 11:07:54 PM PST by 80skid
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

On the shelves in time for Christmas.


13 posted on 11/25/2015 11:34:09 PM PST by kanawa
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin
I've seen pics of these little fellas before - they look like a cross between a caterpillar and an overstuffed sofa. Too bad they're so small. I bet they'd make a great domestic pet. Bet those claws would give a cat a run for it's money on the furniture, though.


15 posted on 11/26/2015 1:43:34 AM PST by Viking2002 (The Avatar is back by popular request.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Those grasping claws are a dead giveaway. This is the ancestral creature from which is descended the modern Gimmedat. A clearer proof of devolution would be hard to imagine.


17 posted on 11/26/2015 3:17:06 AM PST by sphinx
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Looks like a love seat from Ikea.


18 posted on 11/26/2015 3:35:39 AM PST by XEHRpa
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

An example of how life 1st got to earth?


30 posted on 11/26/2015 9:44:18 AM PST by TruthWillWin (The problem with socialism is that you eventually run out of other peoples money.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Lamarck would approve.


31 posted on 11/26/2015 2:39:18 PM PST by backwoods-engineer (AMERICA IS DONE! When can we start over?)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin
True Facts About the Sea Pig
32 posted on 11/26/2015 2:44:57 PM PST by Joe 6-pack (Qui me amat, amat et canem meum.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin; Salamander; SunkenCiv
Like every other living thing, this little creature can fall victim to merciless parasites.

Read the horror story here:
http://dailyparasite.blogspot.se/2014/08/ballocephala-sphaerospora.html

and the result:



Illustration by Lizzie Harper of Ballocephala sphaerospora that has infected a tardigrade.

42 posted on 12/06/2015 10:52:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin


46 posted on 12/06/2015 12:20:33 PM PST by JoeProBono (SOME IMAGES MAY BE DISTURBING ’VIEWER DISCRETION IS ADVISED;-{)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: BenLurkin

Not so tough after all.

....a living tardigrade that's not in the cryptobiotic state is actually pretty fragile.
If you stuck a living, active tardigrade directly into liquid nitrogen, boiling water, your own stomach acid, etc. etc., you'd kill it instantly.
Your own immune defenses would make short work of any tardigrade that got into your bloodstream.
Tardigrades can get attacked by viruses and bacteria and fungi and predatory nematodes, and they can be physically damaged as well.
There are lots of things that can kill them.





55 posted on 01/17/2016 9:10:22 AM PST by Koracan
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson