Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Weird Cat Facts: 8 Reasons Your Cat Likes to Lick You
Catster ^ | Feb 23rd 2015 | JaneA Kelley

Posted on 03/03/2015 3:50:18 PM PST by Slings and Arrows

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 last
To: wyokostur

“Thought they were taste testing me to see what I will taste like when they kill me.”

That’s true. But I had also heard that this is the way they obtain DNA samples to send back to the Mother Ship.


41 posted on 03/04/2015 11:37:32 AM PST by MplsSteve
[ Post Reply | Private Reply | To 26 | View Replies]

To: Rodamala

Thank you for the ping.

I’m in the middle of chemotherapy, and I stink! My cats do not
lick me now, but when it’s over, I’m sure they’ll resume again.


42 posted on 03/04/2015 12:30:56 PM PST by TheOldLady (Pray for Obama... Psalm 109:8 -- Look it up...... I donate monthly. Do you?)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Gefn
I love the way their tongues are like sandpaper.

I had a cat who would jump in bed with me and lick my eyelids if I didn't get up to feed her in the morning at the time she thought she should be fed. OUCH!! That sandpaper tongue was not so attractive at that moment.

43 posted on 03/04/2015 12:36:25 PM PST by Hoffer Rand (Bear His image. Bring His message. Be the Church.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Daffynition

love that....funny


44 posted on 03/04/2015 1:51:29 PM PST by goat granny
[ Post Reply | Private Reply | To 27 | View Replies]

To: Slings and Arrows

Andy never licks me…he nudges tho.


45 posted on 03/04/2015 4:11:21 PM PST by Veto! (Opinions freely dispensed as advice)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Veto!

Kitty head-butts rock.


46 posted on 03/04/2015 8:10:21 PM PST by Slings and Arrows ("Heaven (I'm Already There)" - http://youtu.be/Eh_eGF3xvmw)
[ Post Reply | Private Reply | To 45 | View Replies]

To: RushIsMyTeddyBear

Mine likes to lick all the lotion off my hands


47 posted on 03/04/2015 9:25:29 PM PST by Califreak (Hope and Che'nge is killing U.S./CDC=Contagion Distribution Center)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Slings and Arrows

Zoonotic Disease: What Can I Catch from my Cat?
http://www.vet.cornell.edu/FHC/health_resources/Zoonotic.cfm


48 posted on 03/05/2015 3:21:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-48 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson