Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

To: PIF; All

“GOOD CATCH ‼️ The captured Kadyrovite in the video below is 46-year-old Magomed Zarakhmatov . Once the head of the administration of the village of Valargtle (Valerik).

Ishkerian channels report that he is a personal acquaintance of Kadyrov.

Let’s see how much he is worth”

https://x.com/PStyle0ne1/status/1825280900105375768


5,465 posted on 08/18/2024 2:44:21 PM PDT by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 5464 | View Replies ]


To: SpeedyInTexas
More problem for Kadyrov, from a Russian blogger:

Conflict with “Akhmat” in Kursk Region Ends in Beating of Store Owner

Unfortunately, the unexpected cutting off of Glushkovsky District from the rest of Kursk Region has led not only to growing panic, but also to the first conflicts with the military. The previous morning, a car with military personnel drove up to a local store to stock up on provisions. According to our information, they were “Akhmat” fighters who wanted to get food and water from local residents.

The seller (who was also the owner) refused to provide food to the military without any documents. Frankly speaking, this is a strange position, but nevertheless. The dialogue escalated into a conflict, which ended with a serious beating of the store owner. The military still took the food, and, according to local residents, they also took the cash register that was in the store.

We understand everything - war. But we would like the Ministry of Defense and the Ministry of Internal Affairs to conduct an investigation into this incident. Our military personnel are not looters! We would like to address Apti Alaudinov separately - bring order to your ranks! It may happen that your resignation will happen even faster than many think.

https://t.me/kremlin_secrets/4535

https://en.wikipedia.org/wiki/Kadyrovites

5,474 posted on 08/19/2024 1:01:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 5465 | View Replies ]

To: SpeedyInTexas

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

Reporting From Ukraine Uncensored Combat Footage (from this and past Reports) is found on Telegram:
https://t.me/RFUEnglish or @RFUEnglish
[ You need to have the Telegram app to view. ]

The complete transcript.

[ Checkmate. Russians Beg to Negotiate Returning of Thousands of Captured Conscripts ]


Today [ Aug 19 ], there are a lot of updates from the Kursk direction.

The most interesting news comes from the area of Korenevo. The Ukrainians successfully advanced around the town, achieving an operational encirclement and capturing 100s of Russian soldiers in the process. The situation with the prisoners became so critical that Russian officials requested negotiations for an exchange, aiming to recover over 2,000 newly captured Russian soldiers, most of whom were conscripts.

Ukrainian forces reached Korenevo several days ago, where the Russian command has concentrated most of their combat-ready troops in the region. Russian fighters predominantly concentrate in larger regional towns to defend against major Ukrainian assaults. However, due to their focus on protecting these larger cities, many villages and open areas remain unprotected, with most forces assigned to defend just Korenevo.

This has allowed Ukrainian sabotage and reconnaissance groups, along with larger mobile mechanized units, to advance through smaller villages surrounding Korenevo, effectively bypassing the Russian stronghold.

In this way, the Ukrainians significantly expanded their advance toward Korenevo, capturing the villages of Olgovka, Matvyevka, and Zhuravli to the north of the town. Additionally, Ukrainian forces seized control of Krasnooktyabrske and Komarovka to the south.

This expansion of Ukrainian-controlled territory on the flanks of Korenevo could lead to the encirclement of the Russian garrison, potentially forcing them into a withdrawal or mass surrender, as Russian defenses outside the town are minimal.

To disrupt Russian logistics and capture as many Russian soldiers as possible, elite fighters from the Ukrainian 82nd Assault Brigade and Special Forces Operators, ambushed Russian convoys on key supply routes.

Combat footage released by the 82nd Assault Brigade shows a small Ukrainian sabotage and reconnaissance group ambushing and destroying a convoy of 3 Russian supply trucks, armed only with small arms. The group also managed to capture several Russian soldiers who were part of the convoy.

Following the ambush, part of the Ukrainian unit withdrew to a nearby forest to change positions and prepare for a new ambush, while the main force remained to recover the wounded Russians and secure captured equipment.

The largest recent surrender of Russian troops occurred when 102 soldiers were captured by the Special Forces of the Security Service of Ukraine. Ukrainian Special Forces Operators uncovered a hidden underground bunker stocked with large quantities of ammunition and supplies, guarded by over a 100 Russian troops. Caught completely off guard and unprepared for battle, the Russian garrison decided to surrender.

Among the captured prisoners were members of the more professional Chechen Akhmat fighters. It’s likely that the Security Service of Ukraine, a highly capable intelligence agency, leveraged its extensive network of agents and informants to locate and infiltrate the bunker, leading to one of the largest single surrenders of Russian forces in the entire war.

To date, Ukrainian forces have captured over 2,000 Russian soldiers in Kursk, which President Zelensky has referred to as an exchange fund, suggesting the possibility of a future prisoner exchange with Russia.

The capture of such a large number of troops in Kursk has sparked controversy within the Russian public, as many of the captured soldiers were conscripts who had been deployed to Kursk for training, under the assumption that it was a safe location.

This situation led to groups of Russian conscript mothers, organized by NGOs, demanding the exchange of their sons for Ukrainian Azov fighters held in Russian captivity since the Battle of Mariupol.

Ukrainian Ombudsman Dmitry Lubinets noted that this marked the first time the Russian government had initiated negotiations for a prisoner exchange. Lubinets emphasized that the crisis with prisoners of war in Kursk had compelled Russia to take the initiative in addressing the issue for the first time.

Ukrainian officials had previously reported that Russian authorities had rejected Ukrainian proposals for prisoner exchanges. Ukrainian Military Intelligence Chief Kyrylo Budanov stated, that Ukraine will prioritize the return of seriously wounded and ill individuals, women, and those who have been in Russian captivity the longest.

In contrast, Russian officials have focused on negotiating the exchange of conscripts, who make up over 80% of the captives from the Kursk area.

Overall, the exchange of prisoners of war became the main concern of the Russian government to prevent potential protests and widespread social discontent.

Further losses of soldiers to Ukrainian captivity in the Kursk region, coupled with territorial losses, can risk loss of support for the war effort.

For the Ukrainians, the exchange of Russian prisoners of war for experienced as of veterans of Mariupol for Russian conscripts, can significantly bolster the fighting strength of the army, as many battle hardened soldiers and officers could once again engage in offensive and defensive operations, not only in Kursk, but across the whole front.


5,487 posted on 08/19/2024 3:59:08 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5465 | View Replies ]

To: SpeedyInTexas

Ukraine Drops Key Russian Bridge In Kursk
While losing the bridge is a blow to Russia’s defense of Kursk, a key Ukrainian city in Donetsk may soon fall.
https://www.twz.com/news-features/ukraine-drops-key-russian-bridge-in-kursk

Clash Report@clashreport
Russia claims it destroyed two more Ukrainian MLRS (they think its HIMARS) in Sumy region.
https://x.com/clashreport/status/1824369889722671246


Jay in Kyiv@JayinKyiv
CNN reporter can’t believe how easily Ukraine is fully invading the Kursk region of Russia. [ Idiot reporter stands in road as vehicles swerve to avoid him. ]
https://x.com/JayinKyiv/status/1824489956506497336


Why Russians advance so quickly on the Pokrovsky direction
https://www.youtube.com/watch?v=0vr3FTe6kZI


Excerpt:
Pokrovsk and Toretsk may be priorities, but they are increasingly in danger of falling to Russia. However, the situation in Donetsk Oblast is becoming increasingly difficult for Ukraine under tremendous Russian pressure.

Russian troops are closing in on Pokrovsk, a key Ukrainian logistics hub, The New York Times reported, citing open-source battlefield maps, “casting doubts on Ukraine’s hopes that its new offensive into western Russia will prompt Moscow to scale back its attacks elsewhere on the battlefield.”

“After capturing several villages in the area and pushing along a railway line, Russian forces are now about eight miles from Pokrovsk, one of Ukraine’s main defensive strongholds in the Donetsk region, according to the maps, which are based on combat footage and satellite images.”

Capturing Pokrovosk would bring Russia “a step closer to its long-held goal of seizing the entire Donetsk region, much of which it already controls. Pokrovsk, a city with a prewar population of about 60,000, sits on a key road linking several cities that form a defensive arc protecting the part of Donetsk that is still held by Ukraine.”

“They have more ammunition, more people,” Mykhailo, a soldier of the 68th separate brigade, who “briefly but meaningfully explains the reasons for the rapid advances,” the outlet reported on YouTube.

“Russian forces continue to pursue a tactical encirclement of Ukrainian forces southeast of Pokrovsk and recently made confirmed advances in the area, the Institute for the Study of War said in its most recent assessment. “A Ukrainian soldier operating in the Pokrovsk direction stated on August 15 that Russian forces have a 10-to-1 infantry advantage in the area and conduct infantry-led assaults from just before sunrise to just after sunset each day. Another Ukrainian soldier stated that Russian forces are fewer than six kilometers from Selydove (southeast of Pokrovsk), which is consistent with ISW’s assessment of Russian advances in the area.”


Russia deploys fake Kilo-class submarine in Sevastopol with H.I. Sutton
https://www.navalnews.com/naval-news/2024/08/russia-deploys-fake-kilo-class-submarine-in-sevastopol/


5,490 posted on 08/19/2024 4:16:21 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5465 | View Replies ]

To: SpeedyInTexas

Can Europe Survive Winter Without Russian Gas?

Analysts are examining that question again, but clearly it becomes less of an issue each Winter.

OilPrice.com reports that Europe still imports about 1/3 of the total amount of Natural Gas (pipeline plus LNG) from Russia that it did in 2021 before the war. (~150 mcm/day, vs 450)

That is going to change at the end of this year, when the transshipment through Ukraine to Hungary, Slovakia and Austria ends. Before that time, storage for this Winter should be well filled.

“The remaining gas flows are roughly split between LNG (4.8bcm in Q2), pipeline flows through Ukraine (4.1 bcm in Q2) and other pipeline routes (primarily flows via Turkey into Bulgaria (3.9 bcm in Q2) as well as a small (negligible) flow via Belarus into Lithuania). Europe has now emerged from two winter seasons with plenty of gas despite dramatically cutting Russian imports.

Europe’s gas stores were nearly 60% full by the end of the winter season in April 2024, a record for the close of the winter season....

...energy commodity analysts at Standard Chartered have reported that there has been zero progress in reducing (Russian) imports since flows through the Nord Stream pipeline system ceased. On the contrary, Europe’s gas imports from Russia have climbed ~50% since Q1-2023.” (from the low baseline when Russia turned off flows at the start of the war - still only 1/3 the pre-war total however)...

...commodity analysts have pointed out that non-Russian LNG flows into the EU have declined by ~140 mcm/d since April, enough, if restored, to replace Russian LNG almost three times over (Indeed, enough to replace all current Russian imports - pipeline and LNG. The infrastructure capacity is already there in total, plus a large margin). According to the analysts, removing the last Russian molecules from the EU is more a matter of political will...

...Bruegel, a Belgium-based economic thinktank... has taken an in depth look at how the EU would fare if the flow of Russian gas to Europe were to be disrupted.

The main conclusion is that the EU could not only go through the next winter without Russian gas, but it could also do so without having to experience economic catastrophe.”

(Russian LNG is not currently embargoed by the EU, but Russian LNG could be sold to other customers at somewhat less profit anyway, so it is not as important/effective for reducing Russian revenue.

Bottom line: Another big chunk of Gazprom’s exports (Druzhba pipeline) is going away in about 4 months, leaving only the Turkstream pipeline operating, of the four major systems before the war - and Europe will do fine without it. Turkey is now building out capacity to fill Turkstream with Azerbaijani and Central Asian gas instead of Russian, at a hectic pace.)


5,504 posted on 08/19/2024 9:24:39 AM PDT by BeauBo
[ Post Reply | Private Reply | To 5465 | View Replies ]

To: SpeedyInTexas

Interesting Articles:

Thousands Of Russian Troops In Kursk Likely Trapped By Blown Bridges
Ukraine is trying to close in on Russian troops south of the Seim River to clear out another pocket of Russia’s Kursk Oblast.
https://www.twz.com/news-features/thousands-of-russian-troops-in-kursk-likely-trapped-by-blown-bridges


Ukraine Pushing Westward In Kursk To Create A “Buffer Zone”
After dropping multiple bridges, Ukraine’s push westward, south of the Seim River, would give it more Russian territory along its border.
https://www.twz.com/news-features/ukraine-pushing-westward-in-kursk-to-create-a-buffer-zone


Palmdale UFO Scare Leads To Revelations About Mystery Drone Incursions Over Secretive Plant 42
While it isn’t clear if the two are related, our investigation into the sightings has revealed that the home to Skunk Works has experienced a very concerning rash of drone incursions.
https://www.twz.com/air/palmdale-ufo-scare-leads-to-revelations-about-mystery-drone-incursions-over-secretive-plant-42


Laser Weapon Appears On Chinese Amphibious Assault Ship
A Chinese Type 071 amphibious transport dock has emerged from a refit sporting a new laser directed energy weapon system.
https://www.twz.com/air/laser-weapon-appears-on-chinese-amphibious-assault-ship


5,566 posted on 08/21/2024 4:46:55 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 5465 | View Replies ]

To: SpeedyInTexas
What the heck?

Today Zelenskyy has banned the Church in Ukraine.

Dozens of priests will be thrown to prisons! They got into people’s souls!

The God was kicked out of Ukraine

Keep telling about it! Tell the world that Zelenskyy is doing evil! pic.twitter.com/7ea5uyc9RD— Diana Panchenko 🇺🇦 (@Panchenko_X) August 20, 2024


5,570 posted on 08/21/2024 5:24:55 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 5465 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson