Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

To: gleeaikin
how is this information being conveyed to Russian families or local informing sources,

They probably don't have DNA to identify them.
17,419 posted on 06/17/2025 8:10:35 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17416 | View Replies ]


To: AdmSmith; SunkenCiv; BeauBo

You may have noticed that in my previous comment I made reference to tribes and Siberians. Regional information sources could be provided information related to losses of people from their region. My son had his DNA tested, and it also offered a back description of his father and his mother (me). My maternal grandparents came from East Prussia (Lithuania), and Pozen (Poznan) Poland. My information showed a strong Baltic component, but also a far, far East component ranging from 6 to 9%. Since my grandmother was Prussian petit nobility (von) was her fathers title, I suspect the far, far East may have come from the Golden Hoard or some other Hun or Asian conquest. I do know that Putin is taking many of the ethnic minorities for his slaughter, and those people should be made aware of all the dead from their regions and ethnicities even if individual persons cannot be identified.


17,426 posted on 06/17/2025 11:58:02 AM PDT by gleeaikin (Question Authority: report facts, and post theihr links')
[ Post Reply | Private Reply | To 17419 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson