Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

To: gleeaikin; BeauBo; PIF; FtrPilot
Кремлевская табакерка
Many have asked: where did Patrushev disappear to?

Aide to the President of the Russian Federation, Chairman of the Russian Maritime Collegium Nikolai Patrushev announced that Vladimir Putin approved the Strategy for the Development of the Russian Navy until 2050. This is actually one of the tasks that Nikolai Platonovich has been working on over the past year. Sources familiar with the document say that it is comprehensive and includes all the key trends in the situation at sea, as well as information on geopolitical changes in general. Much attention is paid to the Arctic , the struggle for which is happening before our eyes.

It also separately talks about the need to find new solutions to regain influence in the Black Sea. Including by returning some of the ships from Novorossiysk to Sevastopol. But to do this, it is necessary to strengthen the protection of the Crimean Peninsula, including from naval drones. The best defense would be to take control of the Odessa region and restrict Ukraine's access to the sea. In addition, the document talks about finding mechanisms to influence Turkey in this region. Which not only has its own fleet, but also controls the passage through the Bosphorus. And at the same time, it is increasing its influence in the region.

In general, the preparation of the document lays the foundation for changes in the fleet caused by the development of new technologies and changes in the doctrine of using both the unmanned component and the frigates, large landing ships and boats that we are accustomed to. By the way, we recommend reading the interview with Nikolai Patrushev, which will be published on the website and in the latest issue of the weekly Arguments and Facts . [see below] There is a lot of interesting stuff there.
https://t.me/kremlin_secrets/5776

Strategic Depth. Patrushev Names New Targets for Russian Fleet

Patrushev: The decision to prepare the Strategy was made back in July last year at a meeting in the Kremlin. On the instructions of the President, the Ministry of Defense prepared its draft, which was then revised by the Russian Naval Board taking into account proposals from federal departments and organizations. The final version of the Strategy was submitted to the head of state for consideration, and he approved it on May 30.

P: Without going into details, I will say that such a strategic planning document has been adopted for the first time in modern history. This once again emphasizes that the development of a powerful and modern fleet is a priority for our country. And Russia's position as one of the greatest maritime powers in the world is gradually being restored.

Q: Along with the Navy, the Coast Guard, which is part of the FSB Border Service, also participates in protecting Russian interests at sea. Will it also be strengthened?
P: Of course. The decree of the head of state approved the Strategy for the development of the ship composition of the Federal Security Service for the period up to 2050.

Q:I can't help but ask you about the “price of the issue”. The construction of warships will obviously require considerable budget expenditures? To what extent are such investments justified?

P: In the coming decade, serious allocations are indeed provided for the construction of new ships and vessels of the Navy, which must be taken into account when forming the state armament program. And the state will seek unconditional fulfillment of contractual obligations from factories, shipyards and state customers.

https://aif.ru/politics/russia/strategicheskaya-glubina-patrushev-nazval-novye-celi-dlya-rossiyskogo-flota

An unrealistic project, there is no money.

16,920 posted on 06/09/2025 9:42:47 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16726 | View Replies ]


To: AdmSmith; PIF; BeauBo; FtrPilot

You are right, “There is no money”. Russia has also suffered other losses to their far east Russian naval hopes. A ship carrying important heavy equipment for either a submarine or heavy Arctic ice cutting ship or perhaps both, sank in the Mediterranian last year. After leaving the Baltic Sea, it suffered heavy Atlantic storms while traveling to the Suez Canal. and failed completely while in the Mediterranian Sea. This loss will also set back Russian plans even if they can find or make replacement parts lost when this ship sand.

It was reported this ship was also carrying heavy cranes perhaps for use in a new Russian home in Libya, or even Sudan, after Syria became a no longer friendly home. It must suck to be Putin with all this bad news.


16,922 posted on 06/09/2025 10:22:12 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 16920 | View Replies ]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Largest Microelectronics Factories Destroyed! ]

Today [ June 10 ], there is a lot of interesting updates from the Russian Federation. Here, Ukraine is launching a coordinated campaign across Russia’s military-industrial heartland, to cripple the Kremlin’s ability to wage high-tech war. With a devastating cyberattack on the Tupolev Design Bureau and precision strikes on microelectronics plants, Ukraine is not just targeting weapons, it is forcing Russia’s production capabilities back to the Stone Age.

The Ukrainian Operation Spiderweb inflicted significant losses on Russia, with 25 strategic aircraft confirmed damaged or destroyed. Notably, Russian authorities are already trying to hide the extent of the damage by swapping out destroyed bombers for intact ones, taken from airfields not hit by the strikes.

To complement the severe blow against the Russian strategic bomber aviation, the Ukrainian Military Intelligence conducted an extensive cyberattack on the Tupolev Design Bureau, which designs and produces all Russian strategic bombers. Ukrainian intelligence gained access to more than 4 gigabytes of sensitive data.

The leaked files include internal correspondence between company executives, personal data of employees, home addresses, biographies of engineers and designers, procurement documents, and classified disclosures from closed-door meetings.

The breach provides Ukrainians with comprehensive insight into operations and personnel involved in maintaining Russia’s strategic aviation fleet. This information could be used for the sabotage of the plant, through low-ranking aviation engineers who can be recruited into Ukrainian information networks, with humans always being the weakest link in such large-scale organizations.

Additionally, to cement the inability of Russians to rebuild their strategic bomber fleet, the Ukrainians decided to strike factories that produced other high-tech components necessary for the Russian war effort. These factories produce various microchips and technology essential in the production of Russian bombers, tanks, missiles, guidance systems, vision sights, and radars.

The Ukrainians most recently struck the Avangard microchip and radio-electronics factory in St. Petersburg. The Avangard plant, where a massive fire broke out, produces radio electronics, microchips, and communication systems used in ballistic and cruise missiles, with even Russian authorities listing it as one of the most strategically important facilities.

While Russian media initially claimed that all Ukrainian drones were intercepted, Russian emergency services confirmed a major fire in the section of the plant responsible for microchip production and assembly. Thick black smoke was seen rising from the facility, with the blaze covering around 100 square meters.

Before that, Ukrainian drones targeted the Bolkhov Semiconductor Device Plant, scoring multiple direct hits on the main building. The explosions triggered extensive fires that spread across the facility, causing significant damage and putting the factory out of commission.

Earlier, the Strela microelectronics plant in the town of Suzemka, Bryansk region, was struck. Located just 8 km from the Ukrainian border, it was within range of HIMARS strikes, which caused the most extensive damage of all the targeted Russian military-industrial plants. Satellite imagery later confirmed that nearly the entire facility was destroyed, leaving no operational production capacity.

Finally, the Ukrainians hit the Kremniy El microelectronics plant in the city of Bryansk, one of Russia’s largest microelectronics producers, supplied parts for Pantsir systems and Iskander missiles, delivering multiple strikes that ignited a large fire throughout the site.

This was the 5th attack on the Kremniy El plant since the start of the war, but the latest damage appears to be the most devastating yet. The Ukrainian strikes had a major impact, targeting key sites in Russia’s military-industrial complex.

The strike on the Bolkhov plant was even more severe, disrupting the production of critical components for Sukhoi fighter jets, Iskander ballistic missiles, and Kinzhal hypersonic missiles.

The Strela plant in Suzemka, which produces microchips for systems like the Tor air defense platform, was entirely reduced to rubble and must be rebuilt from the ground up.

These strikes severely limit Russia’s ability to produce advanced weaponry, forcing a shift to lower-tech solutions that reduce combat effectiveness and increase frontline losses.

Overall, the Ukrainians conducted some of the most devastating strikes on the Russian military industry in recent months. With over 30% of Russia’s nuclear capable strategic bombers destroyed Ukrainians are now starting to dismantle their ability to build these weapons entirely.

The breach of the Tupelov design bureau’s internal systems means Ukraine now possesses Russia’s most sensitive data on its strategic bomber designs and still active aircraft, fueling future precision strikes and covert operations, placing the remainder of Russia’s bomber fleet at serious and growing risk.

https://www.youtube.com/watch?v=wFT1h2n3vhA


17,002 posted on 06/11/2025 9:35:20 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16920 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson