Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 0putinsfolly; 0putinswar; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynow; anydaynowputinwins; anydaynowrussiawins; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; jonputinbot; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 16,981-17,00017,001-17,02017,021-17,040 ... 22,521-22,525 next last
To: JonPreston
********* 🍈


15,001 posted on 04/19/2025 6:00:31 AM PDT by JonPreston ( ✌ ☮️ )
*****
17,001 posted on 06/11/2025 9:29:28 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 17000 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Largest Microelectronics Factories Destroyed! ]

Today [ June 10 ], there is a lot of interesting updates from the Russian Federation. Here, Ukraine is launching a coordinated campaign across Russia’s military-industrial heartland, to cripple the Kremlin’s ability to wage high-tech war. With a devastating cyberattack on the Tupolev Design Bureau and precision strikes on microelectronics plants, Ukraine is not just targeting weapons, it is forcing Russia’s production capabilities back to the Stone Age.

The Ukrainian Operation Spiderweb inflicted significant losses on Russia, with 25 strategic aircraft confirmed damaged or destroyed. Notably, Russian authorities are already trying to hide the extent of the damage by swapping out destroyed bombers for intact ones, taken from airfields not hit by the strikes.

To complement the severe blow against the Russian strategic bomber aviation, the Ukrainian Military Intelligence conducted an extensive cyberattack on the Tupolev Design Bureau, which designs and produces all Russian strategic bombers. Ukrainian intelligence gained access to more than 4 gigabytes of sensitive data.

The leaked files include internal correspondence between company executives, personal data of employees, home addresses, biographies of engineers and designers, procurement documents, and classified disclosures from closed-door meetings.

The breach provides Ukrainians with comprehensive insight into operations and personnel involved in maintaining Russia’s strategic aviation fleet. This information could be used for the sabotage of the plant, through low-ranking aviation engineers who can be recruited into Ukrainian information networks, with humans always being the weakest link in such large-scale organizations.

Additionally, to cement the inability of Russians to rebuild their strategic bomber fleet, the Ukrainians decided to strike factories that produced other high-tech components necessary for the Russian war effort. These factories produce various microchips and technology essential in the production of Russian bombers, tanks, missiles, guidance systems, vision sights, and radars.

The Ukrainians most recently struck the Avangard microchip and radio-electronics factory in St. Petersburg. The Avangard plant, where a massive fire broke out, produces radio electronics, microchips, and communication systems used in ballistic and cruise missiles, with even Russian authorities listing it as one of the most strategically important facilities.

While Russian media initially claimed that all Ukrainian drones were intercepted, Russian emergency services confirmed a major fire in the section of the plant responsible for microchip production and assembly. Thick black smoke was seen rising from the facility, with the blaze covering around 100 square meters.

Before that, Ukrainian drones targeted the Bolkhov Semiconductor Device Plant, scoring multiple direct hits on the main building. The explosions triggered extensive fires that spread across the facility, causing significant damage and putting the factory out of commission.

Earlier, the Strela microelectronics plant in the town of Suzemka, Bryansk region, was struck. Located just 8 km from the Ukrainian border, it was within range of HIMARS strikes, which caused the most extensive damage of all the targeted Russian military-industrial plants. Satellite imagery later confirmed that nearly the entire facility was destroyed, leaving no operational production capacity.

Finally, the Ukrainians hit the Kremniy El microelectronics plant in the city of Bryansk, one of Russia’s largest microelectronics producers, supplied parts for Pantsir systems and Iskander missiles, delivering multiple strikes that ignited a large fire throughout the site.

This was the 5th attack on the Kremniy El plant since the start of the war, but the latest damage appears to be the most devastating yet. The Ukrainian strikes had a major impact, targeting key sites in Russia’s military-industrial complex.

The strike on the Bolkhov plant was even more severe, disrupting the production of critical components for Sukhoi fighter jets, Iskander ballistic missiles, and Kinzhal hypersonic missiles.

The Strela plant in Suzemka, which produces microchips for systems like the Tor air defense platform, was entirely reduced to rubble and must be rebuilt from the ground up.

These strikes severely limit Russia’s ability to produce advanced weaponry, forcing a shift to lower-tech solutions that reduce combat effectiveness and increase frontline losses.

Overall, the Ukrainians conducted some of the most devastating strikes on the Russian military industry in recent months. With over 30% of Russia’s nuclear capable strategic bombers destroyed Ukrainians are now starting to dismantle their ability to build these weapons entirely.

The breach of the Tupelov design bureau’s internal systems means Ukraine now possesses Russia’s most sensitive data on its strategic bomber designs and still active aircraft, fueling future precision strikes and covert operations, placing the remainder of Russia’s bomber fleet at serious and growing risk.

https://www.youtube.com/watch?v=wFT1h2n3vhA


17,002 posted on 06/11/2025 9:35:20 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 16920 | View Replies]

To: All
For review and discussion

following the collapse of the Soviet Union

Thank you for referencing the collapse of the Soviet Union. I've been saying this for years despite resistance from the small cadre of Bitter Clingers who post here.
🍈

The price of a borscht set in Russia has increased by 57-87% over the year, with official inflation at 10%. On average, citizens spent 34.6% of their expenses on food, compared to 33% at the beginning of the year and 28.6% in April 2024. According to Romir, this is a record for 5 years

https://bsky.app/profile/evgen-istrebin.bsky.social/post/3lprf4r5erk2a

At least 6000 Russian officers have been eliminated in the Russian invasion of Ukraine since 24 February 2022. Milestone update: +31 newly registered. Sources: public Russian obituaries and graves.

https://x.com/KilledInUkraine/status/1922752446335488341

Officers in a Russian rifle regiment are said to be labelling men as deserters to avoid paying them, beating them, denying medical care, forcing female medics into sex, and sending men into assaults without equipment while telling them to scavenge it on the battlefield. ⬇️

2/ The wives, mothers and sisters of men serving with the Russian 54th Motorised Rifle Regiment have published an ‘appeal to the Tsar’ complaining that their “husbands, sons and fathers are subjected to illegal actions by inhuman beings endowed with power,” i.e. army commanders.
3/ One of the mothers says that in the unit, soldiers are illegally labelled as deserters – even when they are still serving – to deprive them and their families of wages and compensation. They are also denied treatment when they are wounded.
4/ “The fighters are not given medical care, but are handcuffed and beaten. When they leave for a combat mission, the fighters are robbed of their phones, maps, personal belongings, and then all of this is simply lost and disappears.”

5/ “The guys are practically not evacuated. If the guys are wounded, they crawl to the designated place, bleeding. Dead soldiers are not evacuated.
6/ “If the guys are wounded, they end up in the hospital with shrapnel, with serious wounds, they are not sent home for rehabilitation, they are sent back into battle. The guys never return from there.”
7/ They also say that supplies of ‘humanitarian aid’ sent to the soldiers by relatives and volunteers never arrives, but is simply sold (likely by officers or corrupt logistics personnel; this is a common occurrence).
8/ The relatives say that “commanders are asking for money so that servicemen do not go on combat missions.” If soldiers are seen as ‘undesirable’ or insubordinate they are “zeroed out”, or killed.
9/ According to the relatives, men are sent into assaults with little equipment and are told to scavenge what they need on the battlefield, presumably from the corpses of those who were sent before them.
10/ The relatives ask: “They are sending them to a place from which it is practically impossible to return. They are sending people who are not properly trained or prepared. The question is simple: why is all this being done?”

more text: https://threadreaderapp.com/thread/1923436271117984070.html

This isn't about politics. Getting rid of HQs, trimming top officers, and overhauling the promotional system is something all Americans can embrace.


17,003 posted on 06/11/2025 10:29:43 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 17001 | View Replies]

To: PIF

Is it just me, or have others noticed that Russia’s vaunted retaliation for Operation Spider Web, seems to have petered out, with no significant effect?


17,004 posted on 06/11/2025 6:03:45 PM PDT by BeauBo
[ Post Reply | Private Reply | To 17002 | View Replies]

To: AdmSmith

Deputy Russia Team Lead at ISW, who works on their daily campaign assessment gets interviewed on YouTube. (33 minutes)

https://www.youtube.com/watch?v=tBDE4ctIqKI


17,005 posted on 06/11/2025 6:09:49 PM PDT by BeauBo
[ Post Reply | Private Reply | To 16968 | View Replies]


17,006 posted on 06/11/2025 6:19:55 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 17005 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, June 11, 2025

The Kremlin continues to attack Ukraine using rhetoric presenting an anachronistic reading of Ukraine's history, denying the existence of an independent Ukrainian language and culture, and discrediting the Ukrainian government. Russian Presidential Aide Vladimir Medinsky claimed to the Wall Street Journal (WSJ) in an interview published on June 11 that the war in Ukraine is a war between two countries with a shared language and culture and likened the war to “a conflict between two brothers.”[4] Medinsky’s statement is consistent with other Kremlin rhetoric attempting to portray Ukraine as lacking an independent identity and statehood from Russia — reflective of Russia's war goals that seek Ukraine's complete capitulation to Russia and the installation of a pro-Russian puppet government.[5] Russian State Duma Chairperson Vyacheslav Volodin also reiterated Kremlin rhetorical lines falsely claiming that Ukrainian President Volodymyr Zelensky is illegitimate and only the Ukrainian Verkhovna Rada is legitimate.[6] The Ukrainian Constitution bars the government from holding elections when martial law is in effect, and the Ukrainian government legally cannot abolish martial law while Russia continues to attack Ukraine.[7] ISW continues to assess that Russia is very likely promoting such narratives to set conditions for Russia to withdraw from any future peace agreements with Ukraine at a time of Russia's choosing and to support Russia's long-standing demand that Ukraine acquiesce to regime change and the installation of a pro-Russian proxy government.[8]

Russian officials are also attempting to rhetorically split Ukraine from its Western partners and advocating for an escalation of Russian strike tactics in Ukraine as part of wider efforts to intimidate the West into weakening its support for Ukraine. Russian Presidential Aide Vladimir Medinsky told the Wall Street Journal (WSJ) on June 11 that it is impossible to fight a protracted war against Russia and that Russia always defeats its enemies in protracted wars, citing Russia's 21-year-war with Sweden in the 18th century.[9] Medinsky claimed that Russia will be “forced to respond” if “Ukraine keeps being driven by the national interests of others.” Russian Deputy Foreign Minister Sergei Ryabkov claimed in an interview with Kremlin newswire TASS published on June 9 that European states are the main obstacle to peace in Ukraine and are pushing Ukraine to continue military operations against Russia.[10] Volodin claimed on June 11 that Germany's military support for Ukraine is the reason that Russia has conflict with Germany.[11] Russian State Duma Defense Committee First Deputy Chairperson Alexei Zhuravlev separately called for Russia to strike Ukraine with a second Oreshnik intermediate-range nuclear-capable ballistic missile and implied that Russia may launch an Oreshnik against Ukraine soon.[12] Kremlin officials periodically threaten escalation with the West while accusing the West of escalating the war in Ukraine by providing Ukraine with military aid in an effort to prevent the West from giving further assistance to Ukraine, which plays into Putin's theory of victory.[13]

Russian officials continue to promote anti-NATO and anti-Western rhetoric, likely as part of the Kremlin's continued efforts to prepare Russian society for a potential future war against NATO. Ryabkov claimed in the TASS interview published on June 9 that NATO expansion is an “acute problem” and a “root cause” of the contradictions between the United States and Russia, and that it will be impossible to resolve the war in Ukraine without solving the problem of NATO.[14] Ryabkov stated that the Kremlin demanded a legally binding, long-term guarantee from the United States and NATO in December 2021 that NATO would not expand further nor deploy long-range weapons near the NATO-Russia border.[15] Ryabkov reiterated that the Kremlin's position on this matter remains unchanged and called for NATO to reduce the size of the NATO contingent in Eastern Europe. Russian Ministry of Foreign Affairs (MFA) Spokesperson Maria Zakharova overstated on June 11 NATO defensive measures in Eastern Europe and claimed that NATO General Secretary Mark Rutte is trying to intimidate the population of NATO countries by saying that Russia is a threat to NATO.[16] Russian officials have long used anti-Western and anti-NATO rhetoric to justify and consolidate domestic support for a protracted war against Ukraine and to prepare the Russian domestic audience for a potential future conflict against NATO.[17]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-june-11-2025-0

17,007 posted on 06/11/2025 11:48:19 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16968 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas; ...
Day 1,204 of the Muscovian invasion. 1,140 [average is 830/day], i.e. more than 47 Russians and Norks/h. Vehicles and fuel tanks more than 215% and artillery more than 90% above average. 2 planes. Motorcycles are not counted yet.



1,000,000 in losses (dead and injured).
Estimate an average of 1.8 parents, 0.6 siblings (average 1.42 children/woman and 50 % have one or more siblings) 0.4 children, 1.3 grandparents, 4 cousins, 3.7 cousins grandparents, i.e. about 12 close relatives for each. Thus, about 12 million people are related to those lost. If we assume that 18 other people know each of them (= 18 million), then 30 million Russians have a personal relationship with the “losses”. Russia has a population of 143 million, but 1 - 2 million have left the country, i.e. a population of 141 million. 30 out of 141 -142 = 21%.

This means that about 20% of the Russians have personal relationships with someone who has died or been injured in Ukraine. This has consequences for the regime.
17,008 posted on 06/11/2025 11:56:26 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16970 | View Replies]

The Russian leadership, having found itself, to put it mildly, in an unpleasant situation with the fall in world oil prices, is trying to solve the problem with political intrigues. The main goal of the Kremlin is to disrupt the so-called US nuclear deal with Iran, and here the game is played with an attempt to influence both sides. “Putin” during communication with Trump carefully offers his mediation and promotes conditions favorable to the US, but categorically unacceptable for Iran.

On the other hand, together with the Chinese comrades, the Russian leadership encourages Tehran to reject the conditions proposed by Washington and even the agreed compromises. We must give credit, such a policy brings its results, but the weak link in this chain of intrigues is the health of the leader of China Xi Jinping. According to information from reports that are coming to the Politburo, a change of power is possible in China, and the new comrades will most likely be much more liberal than Xi and company, which means that China and the West will find points of agreement on critical issues to the detriment of the interests of Russia and Iran.

https://t.me/generalsvr/3229


17,009 posted on 06/12/2025 12:22:23 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17007 | View Replies]

To: AdmSmith

A million Russian casualties.

Is that enough to make Putin feel like a big man?

I notice two more planes as well.

Is it just me, or does anyone else notice that Putin is costing Russia a fortune?


17,010 posted on 06/12/2025 1:10:46 AM PDT by BeauBo
[ Post Reply | Private Reply | To 17008 | View Replies]

To: AdmSmith; BeauBo; BroJoeK

A Pitain aide recently said “it is impossible to fight a protracted war against Russia and that Russia always defeats its enemies in protracted wars, citing Rur ssia’s 21-year-war with Sweden in the 18th century.” Well, he needs to wake up and see what century he and Sweden are in now. For quite a few years Sweden had been a neutral and UNOCCUPIED country, but then Putin decided to get greedy and seize all or part of Ukraine. Now, suddenly neutral Sweden is not SO neutral. In fact it has executed the unforgivable act of joining, can you believe it, that horrible body Putin hates and fears so much, NATO. Fix your mind on that fact, Mr. Aide, your boss has done that by attacking Ukraine, he has added two neutralized former enemies Sweden and Finland back to the status of declared active potential enemies if Putin doesn’t get his head out of his hind part and realistically evaluate what a mess he has created for Russian’s future, not to mention his own. With his greedy vainglorious ego, Putin has now saddled Russia with 1,000 more miles of border to defend.

If Putin has any sense, he will pull completely out of Ukraine and Crimea, cut a deal with Trump on rare Earths and other items of trade, and put his soldiers back to work on growing good grain crops for the world market. On part of a peace deal could include Ukranian cooperation with Russian successful transport and shipping of peaceful goods like grain and minerals.

Today Putin can celebrate the glorious loss of 1,000,000 Russian troops who were willing to sell their lives to gratify his vainglory and evil ambition.


17,011 posted on 06/12/2025 1:42:39 AM PDT by gleeaikin (Question Authority: report facts, and post their links)
[ Post Reply | Private Reply | To 17007 | View Replies]

discuss


17,012 posted on 06/12/2025 2:53:06 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 17001 | View Replies]

To: PIF; blitz128; BeauBo; FtrPilot; BroJoeK; gleeaikin; AdmSmith; All
🍈

Marco Rubio, ever the statesman


17,013 posted on 06/12/2025 3:02:35 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 17002 | View Replies]

To: AdmSmith
Thank you for your service and sacrifice.

The Putin must be defeated!


17,014 posted on 06/12/2025 3:44:34 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 17013 | View Replies]

To: BeauBo; gleeaikin
Russia's projected expenses for servicing government debt in 2Q25 will amount to RUB 819 billion. Growth +59% Y/Y. Growth is due to bonds with a variable coupon tied to the key rate

https://bsky.app/profile/evgen-istrebin.bsky.social/post/3lre4k2v5ek2a

17,015 posted on 06/12/2025 4:13:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17010 | View Replies]

To: AdmSmith

"We will do everything to ensure that Nord Stream 2 never works"


Germany declares war on a pipeline they own to 50%

pic.twitter.com/sH2lnLScvk— Lord Bebo (@MyLordBebo) May 28, 2025


17,016 posted on 06/12/2025 7:20:03 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 17015 | View Replies]

To: JonPreston
As we celebrate Pride Month


17,017 posted on 06/12/2025 7:26:02 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 17016 | View Replies]

To: gleeaikin
Today Putin can celebrate the glorious loss of 1,000,000 Russian troops who were willing to sell their lives to gratify his vainglory and evil ambition.

For what it’s worth, there are many True Life In God messages about Russia both before and after the collapse of the Soviet Union.

In one message, Prophecy On Russia from December 13, 1993, there is this quote:

I am ready to show My Compassion on her and I will not be slow if she welcomes Me eagerly; I will not delay to show her how I, the Almighty, can eliminate the arrogant and break their lawless sceptres; but, if she will perverse the liberty I have just given her and will put Me out of her mind, even for just a while, I will allow an enemy to invade her …. if Russia will not come back to me with all her heart and acknowledge Me with an undivided heart, as her Saviour, I will send a vast and mighty host in her and from her to all nations, a host such as has never been before, such as will never be again to the remotest ages, and the sky will turn black and will tremble, and the stars will lose their brilliance ….
I have long wondered about the messages in general, the Russia messages especially so, and this message specifically>

Who or what is this “vast and mighty host” and are we witnessing this now?

17,018 posted on 06/12/2025 8:42:45 AM PDT by GBA (Endeavor to persevere. Onward through the fog …)
[ Post Reply | Private Reply | To 17011 | View Replies]

To: GBA
The Kremlin saw “bad signs” and thinks they are “not praying enough”

Successful attacks for the enemy on our A-50 aircraft and on the Novolipetsk Metallurgical Plant, which occurred before and on the second anniversary of the start of the Northern Military District in Ukraine, are “bad signs.”

This opinion was expressed to us by an influential source in the Kremlin. “A lot of bad things are happening. They hit the Lipetsk plant with drones, and now it won’t work for a month and a half or two.

“And this will have a bad impact on our military industry. Such an important plane was shot down. The President was going to fly on it, after all. Everything is somehow going wrong,” he said.

Our interlocutor is especially frightened by the fact that the A-50, right before the tragedy and was urgently consecrated with the icon of the Savior Not Made by Hands, which Vladimir Putin presented to the VKS.

“Is God really turning away from us? On the second anniversary of the SVO, it shows that we pray little, not enough. And that’s why we haven’t won yet. But it’s okay, let’s pray harder. We will fight better!” - says the source.

According to him, this opinion is shared by many influential people in the AP and in the army. The interlocutor refused to answer whether the President thinks the same.

At the same time, he reported that Patriarch Kirill recently proposed holding a large prayer service for Russian weapons. Vladimir Vladimirovich has not yet responded anything about his participation in this event.

Let us note that not everyone in our elites shares this opinion.

“The fact that we have not strengthened our air defense, often give ill-conceived orders, do not take care of people and persecute those who honestly talk about losses, is not connected with prayers.

Something just needs to change. “Not only In the Ministry of Defense,” a high-ranking source in the General Staff told us.

He refused to give forecasts about what events await us next within the framework of the North Military District.

17,019 posted on 06/12/2025 9:05:56 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 17018 | View Replies]

To: GBA

this “vast and mighty host” is getting its rear end kicked by a small country with no “vast and mighty host”.

Must mean the Chinese or something.


17,020 posted on 06/12/2025 9:15:04 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 17018 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 16,981-17,00017,001-17,02017,021-17,040 ... 22,521-22,525 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson