Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Large cross on Lesbos leveled to the ground because it could be 'offensive to Muslim migrants'
Voice of Europe ^ | 11 October 2018

Posted on 10/11/2018 8:02:05 PM PDT by Mr. Mojo

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-47 next last
To: DIRTYSECRET

Woman poet Sappho was from Lesbos Hence the source of the term for homosexual women as she was allegedly overly fond of her own sex.


21 posted on 10/11/2018 8:51:18 PM PDT by KC Burke (If all the world is a stage, I would like to request my lighting be adjusted.)
[ Post Reply | Private Reply | To 13 | View Replies]

To: Mr. Mojo

The spirits of LaVallette and his Knights Hospitaller who defended Malta alone against the muslim hordes of Suleiman the Magnificent must be thrilled to see that christian symbols are being demolished because muslims don’t like them.


22 posted on 10/11/2018 8:56:10 PM PDT by pepsi_junkie (Often wrong, but never in doubt!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo

Did anyone else initially mis-read the headline like I did?

I assumed that a story about large, cross lesbos had to do with more of those stupid anti-Kavanaugh protests.


23 posted on 10/11/2018 9:11:56 PM PDT by Junk Silver ("It's a little hard to herd people onto trains when they're shooting at you." SirLurkedalot)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo
Watch and weep...The Souliot Women and the Dance of Zalongo

https://www.youtube.com/watch?v=pZGAPbzUiqM

Let's see if they can get these statues toppled:


24 posted on 10/11/2018 9:20:40 PM PDT by spokeshave2 (Trump’s building an underground railroad - a way off the plantation to freedom, jobs, and dignity)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo
This after a group claiming to promote intercultural coexistence argued that the cross could be perceived as offensive to the predominantly Muslim boat migrants.

What was that about intercultural coexistence again? I can't hear you over the sound of Christian culture being destroyed.

25 posted on 10/11/2018 9:24:08 PM PDT by Disambiguator (Keepin' it analog.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo

Did they destroy the Cross legally, or illegally? It’s totally wrong either way, but I am wondering if the perpetrators can be arrested and the Cross rebuilt. Whoever was behind this need consequence.


26 posted on 10/11/2018 9:50:16 PM PDT by Bellflower (Who dares believe Jesus? He says absolutely amazing things, which few dare conside. r.)
[ Post Reply | Private Reply | To 1 | View Replies]

Islam is a war plan. Don’t capitulate.


27 posted on 10/11/2018 9:51:41 PM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo

So fuching what if godam savage moslems are offended or not?


28 posted on 10/11/2018 9:58:49 PM PDT by Secret Agent Man (Gone Galt; Not Averse to Going Bronson.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo

PC lunacy .


29 posted on 10/11/2018 9:59:50 PM PDT by hal ogen (First Amendment or Reeducation Camp?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: redshawk

They are similar to the LIB lunatics .


30 posted on 10/11/2018 10:01:56 PM PDT by hal ogen (First Amendment or Reeducation Camp?)
[ Post Reply | Private Reply | To 15 | View Replies]

To: Mr. Mojo

.
Its OK, crosses are sungod worship, not ‘christian’ in any way.

Yeshua was hung on a “T” bar that was dropped on top of a post that was permanently set in the rock.
.


31 posted on 10/11/2018 10:03:14 PM PDT by editor-surveyor (Freepers: Not as smart as I'd hoped they'd be)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo

Get the damn Muslims OUT!!!!


32 posted on 10/11/2018 10:22:36 PM PDT by ZULU (MAGA)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo

Where’s the 300 when you need them?


33 posted on 10/11/2018 11:56:23 PM PDT by broken_arrow1 (I regret that I have but one life to give for my country - Nathan Hale "Patriot")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo

Muslims are for killing; all of them.


34 posted on 10/12/2018 2:12:28 AM PDT by carriage_hill (Life is simpler when you plow around the stump.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo

Wait a minute... I’ve seen this movie before!

35 posted on 10/12/2018 2:36:12 AM PDT by Haiku Guy (ELIMINATE PERVERSE INCENTIVES)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo

So much for coexistence. More leftist hypocrisy.


36 posted on 10/12/2018 3:29:11 AM PDT by virgil (The evil that men do lives after them)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mr. Mojo; VietVet

In the original source https://www.lesvosnews.gr/32506/poy-vadizoyme-gkremisan-to-stayro-stin-apeli-ellines-christianoi-theloyn-na-stithei-ekei-enas-terastios-stayros/

it is stated that
1) the crucifix was build in September 2018
2) it was vandalized by “someone”
3) appeals have been made to the Greek Orthodox Church to open an account for people to donate money for a new larger crucifix

“someone” is trying to make a mountain out of a molehill, why?


37 posted on 10/12/2018 3:58:01 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: fieldmarshaldj

Shameful.


38 posted on 10/12/2018 4:34:07 AM PDT by Eric in the Ozarks (Baseball players, gangsters and musicians are remembered. But journalists are forgotten.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Mr. Mojo

If immigrants don’t like it here, then get the heck out.


39 posted on 10/12/2018 5:01:42 AM PDT by bgill (CDC site, "We don't know. how people are infected with Ebola.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: Secret Agent Man

1 Corinthians 1:18


40 posted on 10/12/2018 5:15:48 AM PDT by Salamander (My Soul's On Fire... [I miss you, Shibumi])
[ Post Reply | Private Reply | To 28 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-47 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson