Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Spanish flu: the killer that still stalks us, 100 years on
The Guardian ^ | 09-09-2018 | Mark Honigsbaum

Posted on 09/09/2018 9:42:57 AM PDT by NRx

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-68 last
To: NRx

Nothing spreads the flu faster then an air plane be careful.


61 posted on 09/09/2018 3:56:34 PM PDT by Vaduz (women and children to be impacIQ of chimpsted the most.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Robert A Cook PE
...an American training camp near swine herds (swine flue link is credible as a mutation), is central Kansas months earlier than Nov 1918.

So I exist because my grandfather's unit, 1st Colorado Infantry, was sent to California to organize instead of Kansas. Luck of the draw.
62 posted on 09/09/2018 5:49:04 PM PDT by nicollo (I said no!)
[ Post Reply | Private Reply | To 30 | View Replies]

To: null and void

I’d add elderberry syrup to that mix. Once a day as a preventative, and every 3 hours the first few days if you do get infected. There is a compound in elderberries that interferes with the flu virus’ ability to infect new cells.


63 posted on 09/09/2018 6:12:01 PM PDT by Ellendra (A single lie on our side does more damage than a thousand lies on their side.)
[ Post Reply | Private Reply | To 19 | View Replies]

To: Robert A Cook PE

I remember reading that there aren’t enough saline IVs to meet the current demand as it is. No way are we prepared for an epidemic like that.


64 posted on 09/09/2018 6:17:47 PM PDT by Ellendra (A single lie on our side does more damage than a thousand lies on their side.)
[ Post Reply | Private Reply | To 31 | View Replies]

To: NRx
My great grandparents died from the flu.

My grandfather who was the eldest, had to give up his dream of finding his fortune in Dayton and stay home to run the farm and raise his seven surviving siblings.

65 posted on 09/09/2018 6:21:47 PM PDT by Harmless Teddy Bear (Somewhere there's danger, somewhere there's injustice, and somewhere else the tea is getting cold.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: NRx

My father had it at a very young age, survived it and died in his 90s having never had any kind of flu again.


66 posted on 09/09/2018 6:39:01 PM PDT by 1066AD
[ Post Reply | Private Reply | To 1 | View Replies]

To: NRx; null and void; SunkenCiv; 43north; PAR35
Shanxi is the most likely origin:

source:
https://news.nationalgeographic.com/news/2014/01/140123-spanish-flu-1918-china-origins-pandemic-science-health/
67 posted on 09/10/2018 7:38:06 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mariner

My grandfather was born in 1898. News travelled slow in Texas too. He said it took a week to hear of the Titanic.


68 posted on 09/10/2018 2:48:23 PM PDT by TexasRepublic (Socialism is the gospel of envy and the religion of thieves. Socialism is governmental theft!)
[ Post Reply | Private Reply | To 54 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-68 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson