Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Follow Up: Israeli Government Officials Stand Up For HR McMaster…
Conservative Treehouse ^ | 05 August 2017 | Sundance

Posted on 08/06/2017 2:40:06 AM PDT by blueplum

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-29 last
To: AdmSmith

McMaster Worked at Think Tank Backed by Soros-Funded Group that Helped Obama Sell Iran Nuclear Deal

breitbart ^ | AARON KLEIN
http://www.breitbart.com/jerusalem/2017/08/06/mcmaster-worked-think-tank-backed-soros-funded-group-helped-obama-sell-iran-nuclear-deal/

White House National Security Adviser H.R. McMaster served at a UK-based think tank financed by a controversial, George Soros-funded group identified by the Obama White House as central in helping to sell the Iran nuclear deal to the public and news media.

From September 2006 to February 2017, McMaster is listed as a member of International Institute for Strategic Studies (IISS), where he served as consulting senior fellow.

The IISS has been supportive of the Obama administration-brokered 2015 nuclear accord with Iran, and the group has repeatedly hit back against charges that Tehran has violated the agreement.

McMaster himself has been accused of purging the National Security Council of hardliners on Iran, and he is seen as a leading proponent of the Iran nuclear accord within the Trump administration.


21 posted on 08/07/2017 2:58:36 AM PDT by MarvinStinson
[ Post Reply | Private Reply | To 17 | View Replies]

To: blueplum
The Conservative TreeHouse should stop abusing the image of Andrew Brietbart. He would have no time for these mentally useful idiots for the left. In the real world an unnamed source never speaks for an administration, much less a country. To use this as a jumping off point to go into gross antisemitism with claims of "America-Second" and "Israel-first" isn't just being wrong. It's an objective declaration of mental illness. This putz should be writting with nothing sharper than a crayon.

MMaster has written and said nasty anti-Israel things. He's been called out for it. This antisemitic attack on those supporting him inoculates him against the truth of his pro-Islamist record and protects the traitors and knaves protecting him.

You are a few Thorazine prescriptions short of a full deck, Sundance. Stop writing articles until you understand why your article should never have been written.

22 posted on 08/07/2017 6:46:43 PM PDT by rmlew ("Mosques are our barracks, minarets our bayonets, domes our helmets, the believers our soldiers.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: blueplum; OwenKellogg; Wallaby; Sal; All

https://theconservativetreehouse.com/2017/08/07/liberal-media-and-useful-pawns-unite-to-remove-steve-bannon-from-white-house/amp/

Has this been posted here today? It’s a twist I hadn’t thought of yet. The point he’s making here is that conservatives are being played. Libs and NeverTrumpers think if they can create a big enough rift between Bannon and McMaster, then Trump will have to fire one of them to restore peace. They think Trump would be forced to let Bannon go instead of McMaster.

IOW, the theory is that all this “manufactured chaos” has absolutely nothing to do with McMaster: It’s another attempt to take out Bannon. Look up Hegelian Dialectic concept. I’m pretty sure that’s applicable here. (More on that in a minute).

Not in this article:
The thinking among many Trumplicans on twitter is that Cernovich and others are being paid to turn on McMaster to help create the chaos. (Paid or not, that guy is losing it. Anyone following him needs to pay attention before you retweet anything he posts.) Cernovich et al would be the useful stooges paid with Soros bitcoin money to help create the desired situation of an unsustainable conflict between HRM and SB.

Conservatives have sincere ideological reasons for opposing HRM, and the Dems/NeverTrumpers are allegedly using this opportunity by hiring self-promoters and twitter trolls/bot to attack McMaster. They are suspected of pretending to be conservatives, hoping the combined onslaught will create a trending “#FireMcMaster” hashtag. This would pressure Trump to act (similar to the Flynn situation).

Couple that social media onslaught with an outpouring of HRM support from Libs and NeverTrumpers, and they hope that Trump would decide he could do without Bannon easier than he could do without HRM. I’m not saying all this is accurate so don’t kill the messenger.

Someone smarter than I in philosophy could confirm or deny this as being applicable to the Hegelian Dialectic framework. You can look at this and perhaps see what I’m saying. It makes sense to me, and Dem operatives use this all the time in other areas.

http://3.bp.blogspot.com/-qxtgmMDagE0/Ui4GOFieG_I/AAAAAAAADTo/3i1IM8fSsrg/s1600/hegelian.jpg

https://redgreenalliancedotcom.files.wordpress.com/2016/04/hegelian-dialectic.jpg?w=610


23 posted on 08/07/2017 7:52:47 PM PDT by Nita Nupress (To Wash DC: America is coming. And we're bringing Galt-Right Donald J. Trump with us.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SJackson; AdmSmith

You may be interested in 23


24 posted on 08/07/2017 7:55:33 PM PDT by Nita Nupress (To Wash DC: America is coming. And we're bringing Galt-Right Donald J. Trump with us.)
[ Post Reply | Private Reply | To 23 | View Replies]

To: newfreep; Robert DeLong

23


25 posted on 08/07/2017 7:56:56 PM PDT by Nita Nupress (To Wash DC: America is coming. And we're bringing Galt-Right Donald J. Trump with us.)
[ Post Reply | Private Reply | To 23 | View Replies]

To: LS

23 fyi


26 posted on 08/07/2017 7:58:43 PM PDT by Nita Nupress (To Wash DC: America is coming. And we're bringing Galt-Right Donald J. Trump with us.)
[ Post Reply | Private Reply | To 23 | View Replies]

To: Nita Nupress

Certainly agree that we are dealing with manufactured chaos.


27 posted on 08/08/2017 2:09:56 AM PDT by OwenKellogg (Merry Christmas!)
[ Post Reply | Private Reply | To 23 | View Replies]

To: Nita Nupress

Worth repeating:
The Russians are not working for the Republican Party against the Democratic Party nor for the Democrats against the GOP, they are working against both the Republicans and the Democrats.

and now the Russians are starting to attack the President: https://ria.ru/analytics/20170805/1499810278.html


28 posted on 08/08/2017 2:16:15 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Nita Nupress

Hi Nita, usually I’d respond to your ping right away but I’m about buried in local politics and there’s a local election going on here in Prescott (and lots of money disappeared at the state party level which we’re trying to fix) and I’m waaaayyy behind in reading.

As usual I’m right on with your thinking. Anybody who’d advise the boss to appoint or support known Islamic enemies of our country is NOT to be trusted about anything IMO.

Big example: how about reinstating Susan Rice’s security clearance so she can keep on undermining the Trump administration. I think you’ve cemented your point.

I don’t understand Trump’s keeping this turd on, but then I don’t play a lot of 4 dimensional chess. It could be keeping your enemies closer... I totally agree about the application of Hegelian Dialectic.


29 posted on 08/15/2017 9:20:44 AM PDT by Sal (They're trying to start a civil war. In war the rules change. BAD for all! Especially THEM.)
[ Post Reply | Private Reply | To 23 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-29 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson