Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Kuwait Makes DNA Tests Mandatory After ISIS Bombing
Al Alarabiya ^ | Wednesday, 1 July 2015

Posted on 07/01/2015 2:19:30 PM PDT by nickcarraway

Kuwait’s parliament, reacting to a suicide bombing last week that killed 26 people, adopted a law Wednesday requiring mandatory DNA testing on all the country’s citizens and foreign residents.

The legislation, requested by the government to help security agencies make quicker arrests in criminal cases, calls on the interior ministry to establish a database on all 1.3 million citizens and 2.9 million foreign residents.

Under the law, people who refuse to give samples for the test face one year in jail and a fine of up to $33,000 (29,700 euros). Those who provide fake samples can be jailed for seven years.

(Excerpt) Read more at english.alarabiya.net ...


TOPICS: Extended News; Foreign Affairs; Government
KEYWORDS: dna; kuwait; privacy
How long until this happens here?
1 posted on 07/01/2015 2:19:30 PM PDT by nickcarraway
[ Post Reply | Private Reply | View Replies]

To: nickcarraway

That’ll come in handy next time they’re scraping body parts off the walls.


2 posted on 07/01/2015 2:23:51 PM PDT by moovova
[ Post Reply | Private Reply | To 1 | View Replies]

To: nickcarraway
Makes going after the family members of a suicide bomber easier.

Socialist DemoRats don't need DNA to do that here, now, when someone moneybombs a republican or conservative.

3 posted on 07/01/2015 2:35:13 PM PDT by Navy Patriot (America, a Rule of Mob nation)
[ Post Reply | Private Reply | To 1 | View Replies]

To: moovova

This would not be a problem and would be very beneficial, if people actually trusted trustworthy governments. They don’t, and they aren’t.


4 posted on 07/01/2015 2:37:15 PM PDT by The Antiyuppie ("When small men cast long shadows, then it is very late in the day".)
[ Post Reply | Private Reply | To 2 | View Replies]

To: nickcarraway

Suspect you’re right to ask that seeing the direction we’re heading in.
No need to fear, however. What could go wrong with a national DNA database and corrupt federal bureau of investigation?

http://reason.com/blog/2014/07/30/huge-scandal-at-fbi-dubious-forensic-evi

DNA scandal affects thousands of cases.


5 posted on 07/01/2015 2:41:44 PM PDT by MarchonDC09122009 (When is our next march on DC? When have we had enough?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...
Kuwait's parliament, reacting to a suicide bombing last week that killed 26 people, adopted a law Wednesday requiring mandatory DNA testing on all the country's citizens and foreign residents... to establish a database on all 1.3 million citizens and 2.9 million foreign residents. Under the law, people who refuse to give samples for the test face one year in jail and a fine of up to $33,000 (29,700 euros). Those who provide fake samples can be jailed for seven years.
This will help identify cell samples from suicide bombers.
6 posted on 07/01/2015 2:47:59 PM PDT by SunkenCiv (What do we want? REGIME CHANGE! When do we want it? NOW)
[ Post Reply | Private Reply | View Replies]

To: Navy Patriot
Makes going after the family members of a suicide bomber easier.

I said that long ago as a possible way for Israel to deal with all the suicide bombers, it could be a powerful tool to force the families of the bomber candidates to deal with them before they blew themselves and their victims up.

Where's my check?

j/k...

7 posted on 07/01/2015 3:16:06 PM PDT by W. ( Animals are much stupider since Noah's Ark, because of inbreeding.--Oglaf)
[ Post Reply | Private Reply | To 3 | View Replies]

To: nickcarraway

Hussein is taking notes.


8 posted on 07/01/2015 3:43:19 PM PDT by bgill ( CDC site, "we still do not know exactly how people are infected with Ebola")
[ Post Reply | Private Reply | To 1 | View Replies]

To: nickcarraway; SunkenCiv; nuconvert

That is only post-mortem investigation, better to forbid the use of a burka, hijab etc. Learn from Chad http://gulfnews.com/news/africa/chad-s-ban-on-veil-after-attacks-divides-muslims-1.1538326

http://www.telegraph.co.uk/news/uknews/terrorism-in-the-uk/10438195/The-runaway-terrorist-his-burka-disguise-and-a-compensation-bid.html

http://www.danielpipes.org/blog/2002/03/niqabs-and-burqas-as-security-threats


9 posted on 07/03/2015 7:57:42 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson