Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Russia prepares bill on foreign asset freeze in reply to sanctions Senator
RT ^ | 3-5-2014 | RT

Posted on 03/05/2014 10:19:17 AM PST by tcrlaf

A top Russian lawmaker has revealed he is working on a bill that would freeze the assets of European and American companies operating in Russia in reply to Western economic sanctions.

The chairman of the upper house committee for constitutional law, Andrey Klishas, is sure that Russia must have an enough leverage to deal with the threat of sanctions coming from foreign countries.A team of lawyers are currently preparing a separate federal bill that would allow the Russian president and government to confiscate foreign owned property in Russia, including assets belonging to private companies, the senator told the RIA Novosti news agency.

The bill is in response to the major political crisis in Ukraine and the threat of sanctions against Russia coming from the USA and other countries.

“All sanctions must be mutual,” Klishas stated.

(Excerpt) Read more at rt.com ...


TOPICS: Foreign Affairs; Front Page News; Government; News/Current Events
KEYWORDS: russiaukraine; sanctions
A message being sent to Obama. He is being reminded that this isn't a little country like Libya or Syria he's dealing with.

Retaliatory sanctions would harm Germany and the UK greatly. Several US Companies have significant assets in Russia, too.

1 posted on 03/05/2014 10:19:17 AM PST by tcrlaf
[ Post Reply | Private Reply | View Replies]

To: tcrlaf

Zer0, “Curses, foiled again!”


2 posted on 03/05/2014 10:24:39 AM PST by Vinnie
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf

and then of course, there is China, which is standing by Putin ....


3 posted on 03/05/2014 10:24:47 AM PST by silverleaf (Age takes a toll: Please have exact change)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf

Of course Russia would confiscate all foreign holdings within Russia, duh. The reason that Great Britain has refused to participate is to protect BP. BP runs the British government.


4 posted on 03/05/2014 10:26:15 AM PST by Eva
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf

I’m not sure about this. I think it’s highly unlikely.


5 posted on 03/05/2014 10:28:23 AM PST by Sacajaweau
[ Post Reply | Private Reply | To 1 | View Replies]

To: Sacajaweau

“I’m not sure about this. I think it’s highly unlikely.”

Why???


6 posted on 03/05/2014 10:33:25 AM PST by tcrlaf (Well, it is what the Sheeple voted for....)
[ Post Reply | Private Reply | To 5 | View Replies]

To: tcrlaf

KGB vs. ACORN.

Wasn’t it Kerry who said a couple of days ago that “climate change” was our greatest threat? Does he now see how utterly STOOOOPID he now looks? Between Obama, Kerry, and Hagel the Facists are playing the Marxists like a violin.


7 posted on 03/05/2014 10:34:37 AM PST by Oldeconomybuyer (The problem with socialism is that you eventually run out of other people's money.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf

I don’t know if it’s likely either but Barky’s hollow talk the other day about economic retaliation was just about the only limp arrow he had left in his sad, pathetic little quiver. Now, Russia’s is signaling back “Go right ahead. We’ll do the same and we’ll see where that all gets us. You first.”

As another poster said above, Europe’s general economy is more connected to Russia’s and thus they’d bear the brunt of the pain.


8 posted on 03/05/2014 10:38:28 AM PST by FAA
[ Post Reply | Private Reply | To 6 | View Replies]

To: tcrlaf

I bet “O” never thought that ‘D’ in Geography was going to matter! (OR the ‘F’ in economics....etc.)


9 posted on 03/05/2014 10:43:06 AM PST by SMARTY ("When you blame others, you give up your power to change." Robert Anthony)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf
I am waiting for the Ruskies to shut down our space program over this since we don't have a current or planned launch system which does not depend on the Russians (i.e. rocket motors).

??? WTF ???


10 posted on 03/05/2014 10:49:27 AM PST by SecondAmendment (Restoring our Republic at 9.8357x10^8 FPS)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf

If you have assets in Russia, you might want to get them out now.


11 posted on 03/05/2014 10:49:28 AM PST by 3Fingas (Sons and Daughters for Freedom and Rededication to the Principles of the U.S. Constitution)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SecondAmendment

Great decision by Obama to end the Shuttle program without having a rocket system to replace it.


12 posted on 03/05/2014 10:50:17 AM PST by 3Fingas (Sons and Daughters for Freedom and Rededication to the Principles of the U.S. Constitution)
[ Post Reply | Private Reply | To 10 | View Replies]

To: SecondAmendment

It’s true. We contract with the Russians to send supplies to the ISS.


13 posted on 03/05/2014 10:55:03 AM PST by RinaseaofDs
[ Post Reply | Private Reply | To 10 | View Replies]

To: tcrlaf
And meanwhile the US is giving the Ukraine a billion dollars which will pay Russia for the gas Ukraine needs, at market value?

Mygosh, Russia's going to profit from US get-tough decisions.

Then there's the matter of Russia's wealthy class. Who benefits if they stop spending their money on US things?

14 posted on 03/05/2014 10:56:53 AM PST by grania
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf

Another chess move by the Russian government. These are not times for Amateurs. I’m saying that the US should not be beating its chest and assume any moral authority for situations overseas. These are times for behind the scenes deliberations. Of course, when your counterpart won’t take your calls as in Hagel, well, the writing is on the wall.
Many believe we should avoid foreign entanglements, including myself. It is very difficult to know who all the players are. But standards should be upheld by a coalition of civilized nations. Wait and see who joins us in not going to the G8 meeting. That will tell you what our standing has become.


15 posted on 03/05/2014 10:57:52 AM PST by griswold3 (Post-Christian America is living on borrowed moral heritage)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SecondAmendment

That’s what happens when Obama is more concerned abou muslim outreach than keeping up with a way to reach the ISS.


16 posted on 03/05/2014 11:02:19 AM PST by autumnraine
[ Post Reply | Private Reply | To 10 | View Replies]

To: tcrlaf

Both sides are being unrealistic. If Russia seizes assets how difficult will it be to get foreigners to invest in Russia after this is all over? And, on our side, we really need Russian help to prevent nukes from getting out of the Middle East and being shipped to he US. They have assets we don’t and can’t get.

So, what should we do? Well, the number one thing we can do to earn the world’s respect is replace Obama and the ridiculous changes he’s made in the military. Then, we need an alpha male (or female) president who blusters around pretending to be a lose cannon. Perhaps if he pronounces it nu-cular it will scare them. It certainly scared the Democrats.


17 posted on 03/05/2014 11:27:06 AM PST by Gen.Blather
[ Post Reply | Private Reply | To 1 | View Replies]

To: 3Fingas

Will they also shut down the mail order bride services?


18 posted on 03/05/2014 12:31:42 PM PST by Army Air Corps (Four Fried Chickens and a Coke)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Army Air Corps

Well, there goes my social life. LOL.


19 posted on 03/05/2014 12:36:47 PM PST by 3Fingas (Sons and Daughters for Freedom and Rededication to the Principles of the U.S. Constitution)
[ Post Reply | Private Reply | To 18 | View Replies]

To: tcrlaf
The second Cold War, although the first one never really stopped except for our side.

As Ukraine tension flares, Russia test-fires ballistic missile
http://www.freerepublic.com/focus/f-news/3129501/posts

China Fields New Intermediate-Range Nuclear Missile (Gertz)
http://www.freerepublic.com/focus/chat/3129390/posts?page=6#6

N.Korea Fires Multiple Launch Rockets
http://freerepublic.com/focus/news/3129517/posts

Kiev agitators ‘trained in Poland’ claims Putin
http://www.freerepublic.com/focus/f-news/3129486/posts

Putin Adviser Urges Dumping US Bonds In Reaction to Sanctions
http://freerepublic.com/focus/f-news/3129485/posts

China ups military spend by 12 percent. Are the gloves coming off?
http://freerepublic.com/focus/f-news/3130030/posts

Military’s top general offers grim outlook on nation’s defense
http://freerepublic.com/focus/f-news/3130028/posts


20 posted on 03/05/2014 6:03:58 PM PST by familyop (We Baby Boomers are croaking in an avalanche of corruption smelled around the planet.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf
Russia to set up missile shield for Iran
http://www.freerepublic.com/focus/f-news/1944948/posts

Putin: Russia Building Nuclear Weapon U.S. Won't Have
http://209.157.64.200/focus/f-news/1282021/posts

Russia says new Topol RS-12 mobile ICBM can evade U.S. missile defense
http://www.freerepublic.com/focus/f-news/1513904/posts

S. Korean Lawmaker, “Russia might have given N. Korea know-how of miniature nukes”
http://www.freerepublic.com/focus/f-news/1717327/posts

WikiLeaks: North Korea Shipped 19 Advanced Nuclear-Capable Missiles to Tehran
http://www.freerepublic.com/focus/f-bloggers/2634540/posts

North Korea Tests 'Super-EMP' Nuke
Newsmax ^ | Thursday, 16 Jun 2011 09:05 AM | Ken Timmerman
"North Korea’s nuclear tests have been dismissed as failures by some analysts because of their low explosive yield. But Dr. Pry believes they bore the “signature” of the Russian-designed “super-EMP” weapon, capable of emitting more gamma radiation than a 25-megaton nuclear weapon. "

Georgia Seeks U.N. Security Council Session About Missile
NY Times ^ | August 9, 2007 | C. J. CHIVERS
http://www.freerepublic.com/focus/f-news/1878501/posts
Excerpt:
"No one was injured by the missile, which struck on Monday evening near Tsitelubani, a village about 30 miles from Tbilisi, the Georgian capital. The missile broke apart on impact, but did not explode. The Georgian military later detonated the missile."

China and Russia Call for U.S. Withdrawal in Central Asia
http://www.freerepublic.com/focus/f-news/1437131/posts

US TOLD TO LEAVE CENTRAL ASIA [Russia & China demand "deadline."]
http://www.freerepublic.com/focus/f-news/1437369/posts

Vladimir Putin Justifies His Trust in Islam Karimov (Uzbekistan)
http://www.freerepublic.com/focus/f-news/1433668/posts">

Why Russia should sell weapons to Iran and Syria
RIA Novosti (Russian state-owned outlet) ^ | 08AUG07 |
Marianna Belenkaya, Russian Government
http://www.freerepublic.com/focus/f-news/1878354/posts

Putin: 'Israel's nuclear weapons just make it a target'
http://freerepublic.com/focus/f-news/3068835/posts

Russians Respect Reason For Terrorism
http://www.freerepublic.com/focus/f-news/1210347/posts


21 posted on 03/05/2014 6:11:38 PM PST by familyop (We Baby Boomers are croaking in an avalanche of corruption smelled around the planet.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf

Another reason to get the Keystone Pipeline signed into reality. Republicans, if they had any guts, brains or balls, could and should make this an immediate priority project, and hammer on it through the upcoming elections.

Also, a good reason to demand that Obama and whoever is the current Secy of the Interior, open up Govt owned lands for energy exploration, immediately.

Restrict the EPA from expanding any of their powers, NOW. Reign in this rogue agency and clean house of the leftsts who run it.

The same for Health and Human Services, too. Sebelius is a lunatic.

Also, speed up any nuclear facility applications.

Revive our space vehicles program, ASAP and get rid of Holden or whoever is the NASA clown that is ruining it.

Prohibit Russian investments in any American company or subsidiary. Freeze all their assets.

Reduce their KGB-loaded diplomatic and business presence in the US (I know it is the FSB or something like that, but KGB has an identifiable meaning to the average citizen).

Release all OLD CLASSIFIED FILES ON SOVIET OPERATIONS IN THE US, ESP. INSIDE OF CONGRESS, SAY FROM 1934 (DICKSTEIN) TO 2000, including the Stanley Levison/Jack O’Dell files re Martin Luther King, Jr., the KGB agents who sandwiched Albert Einstein, and Soviet operatives in the US Congress (Bella Abzug, John Conyers Jr., and others).

Release all documents of Sen. Ted Kennedy’s illegal contacts with the Soviets.

Release all documents relating to Soviet operations and assets involved with Barack Hussein Obama, his father, Frank Marshall Davis (re Soviet agents Harry Bridges and Paul Robeson), and the Canter Family of Chicago. THOSE WOULD BE ENOUGH TO GET OBAMA IMPEACHED AND JAILED FOR TREASON.

[The FBI has those files but the question is whether they have destroyed any of them or not. Given our recent Bureau leadership, I’m worried, real worried about them being safe].

Let the citizens of the US (and the world) see what the Soviets/Russians have been doing to us since the 1930’s. Every history book used in high schools and colleges will have to be revised, and a lot of red professors will have their reputations and careers exposed or destroyed.

There are going to be some very interesting surprises if this is done.

I feel that Whitaker Chambers and Elizabeth Bentley only exposed some of the Soviet MKVD/KGB operations inside the US government and related organizations. There is some evidence that at least two more Soviet spy rings existed within the atomic bomb program and/or afterwards (according to the late FBI agent Herb Philbrick and others).

Then we plan to do the same for Red Chinese operations and operatives, both Chinese and American, in the US. Might nail a congresswoman in the process. And clean out Red operations in NYC’s Chinatown and S.F.

Also, we should expose Red Chinese infiltration and virtual takeovers of some of the Pacific islands including Fiji and Tonga, among others.

What you don’t know can kill you.

Thank New Zealand researcher Trevor Loudon and his team for bringing some of this to light, esp. the Soviet agents who destroyed New Zealand-ANZAC alliances in the 1980’s.

Welcome to the wonderful world of subversion and economic warfare. Brought to you by the sheer subversion of marxist Obama and his commies against the US.

And remember, 51% of the US electorate voted this traitor in. Now we are reaping his treason, all for some EBT cards and gay marriage rights.


22 posted on 03/05/2014 7:18:17 PM PST by MadMax, the Grinning Reaper
[ Post Reply | Private Reply | To 1 | View Replies]

To: Oldeconomybuyer

Hillary’s “reset” was a thaw in relations, but Obama’s incompetence has caused a Freeze.


23 posted on 03/05/2014 10:13:08 PM PST by Jumper
[ Post Reply | Private Reply | To 7 | View Replies]

To: MadMax, the Grinning Reaper

Perhaps it would as well be a good idea to expose Putin’s financial assets and take him to court.

http://www.marketplace.org/topics/world/why-not-seize-putins-assets


24 posted on 03/05/2014 10:40:41 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22 | View Replies]

To: tcrlaf; SunkenCiv; Tailgunner Joe; nuconvert; gandalftb

The Russian export in 2012 was $524,564,991,000.
Top ten breakdown:
Mineral fuels including oil: $375,423,947,000 (71.6% of total exports)
Iron and steel: $22,601,664,000 (4.3%)
Fertilizers: $11,176,846,000 (2.1%)
Inorganic chemicals: $7,835,699,000 (1.5%)
Machinery: $7,609,061,000 (1.5%)
Aluminum: $7,281,329,000 (1.4%)
Wood: $6,731,569,000 (1.3%)
Cereals: $6,246,547,000 (1.2%)
Copper: $5,787,339,000 (1.1%)
Organic chemicals: $4,516,890,000 (0.9%)

http://www.worldstopexports.com/russias-top-10-exports/2350

This is a typical third world export mix heavily dependent on raw materials.

Compare this to South Korea with a total export of $548.8 billion in 2012 (i.e. larger than Russia)
Top ten breakdown:
Electronic equipment: $119,084,386,000 (21.7% of total exports)
Vehicles: $70,074,094,000 (12.8%)
Machinery: $58,979,883,000 (10.8%)
Mineral fuels including oil: $57,492,603,000 (10.5%)
Ships, boats and other floating structures: $37,828,429,000 (6.9%)
Optical, technical and medical apparatus: $37,611,611,000 (6.9%)
Plastics: $28,381,150,000 (5.2%)
Iron and steel: $25,375,017,000 (4.6%)
Organic chemicals: $23,284,736,000 (4.3%)
Iron or steel products: $12,467,431,000 (2.3%)

http://www.worldstopexports.com/south-koreas-top-10-exports/2302

The Russians do not know(?) that their export, without the raw materials, is only in the order of $50 billion !


25 posted on 03/05/2014 11:26:03 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: tcrlaf
Well.......just like I've already said about china, US companies should not be there...They are screwing us every chance they get.
26 posted on 03/05/2014 11:29:05 PM PST by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: griswold3
Isolation does not work in any situation that I can think of.

The tyrant will just eat you alive. Just like a snake will always bite you.

It's what they do.

But you must do it smartly. And without hesitation.

What Putin did should have a cost attached to it and that's that....no matter what the hand wringers think.

We have on multiple occasions assured these people that we and the EU would have their backs regarding Russia...

So much for US rhetoric.....apparently it's all bull sheet.

27 posted on 03/05/2014 11:36:24 PM PST by Cold Heat (Have you reached your breaking point yet? If not now....then when?)
[ Post Reply | Private Reply | To 15 | View Replies]

To: AdmSmith

Putin is a professional KGB criminal. He knows how to cover up his financial tracks. A dacha here, another there, under someone else’s name. Same for bank accounts, and what banker in Russia is going to testify about his accounts and live more than a week?

No court in Russia is going to try him. No court in Europe is going to try him. No American court has any jurisdiction to try him, and do you think Obama and Holder want to go up against the KGB/FSB?

Would any newspaper print anything really damning about Putin? Their reporters would disappear like drug-dealers during a police raid, some permanently.

Who knows what they have on both of them, plus most of Congress, the whole damned DC government, others in government?

The deck is stacked in the dealer’s favor and Putin is the dealer.


28 posted on 03/05/2014 11:46:05 PM PST by MadMax, the Grinning Reaper
[ Post Reply | Private Reply | To 24 | View Replies]

To: tcrlaf

You got to have a death wish to do business in Russia anyhow. They don’t exactly play by the rules.


29 posted on 03/06/2014 9:14:35 AM PST by Sam Gamgee (May God have mercy upon my enemies, because I won't. - Patton)
[ Post Reply | Private Reply | To 1 | View Replies]

To: silverleaf

China will expect Russia’s support when they invade Taiwan.


30 posted on 03/06/2014 12:52:34 PM PST by VerySadAmerican (".....Barrack, and the horse Mohammed rode in on.")
[ Post Reply | Private Reply | To 3 | View Replies]

To: MadMax, the Grinning Reaper

Wouldn’t it be something if Putin said “I’m not going to be pushed around by a muslim from Kenya. What? Oh, you want proof? Stand by.”


31 posted on 03/06/2014 12:57:36 PM PST by VerySadAmerican (".....Barrack, and the horse Mohammed rode in on.")
[ Post Reply | Private Reply | To 28 | View Replies]

To: 3Fingas

Russian market and ruble down in 5... 4...


32 posted on 03/06/2014 1:20:54 PM PST by Justa
[ Post Reply | Private Reply | To 11 | View Replies]

To: VerySadAmerican

Taiwan is just a small part of the Chinese goal to establish hegemony in the western Pacific. I’m sure Putin and the Chinese will figure out a way to divide the Pacific between them and deal with Japan and the Philippines


33 posted on 03/06/2014 2:54:19 PM PST by silverleaf (Age takes a toll: Please have exact change)
[ Post Reply | Private Reply | To 30 | View Replies]

To: FAA

yes, the EU bankers wont be shouldering much of the IMF/NATO/western world’s shared expenses if Putin shuts off their natural gas


34 posted on 03/06/2014 2:56:14 PM PST by silverleaf (Age takes a toll: Please have exact change)
[ Post Reply | Private Reply | To 8 | View Replies]

To: SecondAmendment

http://www.foxnews.com/politics/2014/03/05/crimea-crisis-us-soviet-space-program/

manned flights to repair our satellites now depend on Russian transportation


35 posted on 03/06/2014 2:58:17 PM PST by silverleaf (Age takes a toll: Please have exact change)
[ Post Reply | Private Reply | To 10 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson