Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Chicago Pile 70 years tomorrow Dec 2.
Argonne National Lab ^ | 9 jul 2012 | Staff

Posted on 12/01/2012 10:18:37 AM PST by AdmSmith

On December 2, 1942, 49 scientists, led by Enrico Fermi, made history when Chicago Pile 1 (CP-1) went critical and produced the world's first self-sustaining, controlled nuclear chain reaction.


TOPICS: Business/Economy; Extended News
KEYWORDS: alteredsource; alteredtitle; hdptfe; nuclear; power; stringtheory; vanity
We should celebrate the great achievement done 70 years ago. Unfortunately, nothing in MSM.
1 posted on 12/01/2012 10:18:47 AM PST by AdmSmith
[ Post Reply | Private Reply | View Replies]

To: gandalftb; TigerLikesRooster; SunkenCiv

Short video http://www.youtube.com/watch?v=0tKf7R2XncM

long http://www.youtube.com/watch?v=vv_0STVP044

http://en.wikipedia.org/wiki/Chicago_Pile-1


2 posted on 12/01/2012 10:20:52 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

They were excited when it worked and even more excited when their theories on how to stop it worked.


3 posted on 12/01/2012 10:21:03 AM PST by gorush (History repeats itself because human nature is static)
[ Post Reply | Private Reply | To 1 | View Replies]

To: gorush

having served on board a nuclear sub. I have nothing but awe and respect for what they accomplished.


4 posted on 12/01/2012 10:25:53 AM PST by brivette
[ Post Reply | Private Reply | To 3 | View Replies]

To: AdmSmith

Deep down in your hearts, you Right Wing Nuts really know that the author of this article is not talking about either one of us when he uses the term Chicago pile!

5 posted on 12/01/2012 10:30:15 AM PST by Zakeet (Calling the Obozo/Bernack economy sluggish is an insult to slugs)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Remarkable! I never knew the story.

I just finished “Madame Curie”... unbelievable woman, discoveries, contributions.

Thanks for the post.


6 posted on 12/01/2012 10:38:37 AM PST by freeagle
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

If the MSM mentioned it at all, it would be to say what a terrible thing it was.

My dad was a grad student there at the time, though he wasn’t directly involved with building the pile. He was working on the problem of how to separate U-235 from U-238.


7 posted on 12/01/2012 10:38:47 AM PST by Fresh Wind (Cut the cable today!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Zakeet

That would be the Chicago (dog) pile.

8 posted on 12/01/2012 10:43:24 AM PST by uglybiker (nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-nuh-BATMAN!)
[ Post Reply | Private Reply | To 5 | View Replies]

To: AdmSmith

And two and a half years later, BIG BOOM and FLASH over Hiroshima & Nagasaki. War over!!


9 posted on 12/01/2012 10:48:58 AM PST by Elsiejay
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

What was the number of the Chicago Pile that turned into Barry Soetoro?


10 posted on 12/01/2012 10:49:12 AM PST by Arthur McGowan (If you're FOR sticking scissors in a baby girl's neck and sucking out her brains, you are PRO-WOMAN!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
We should celebrate the great achievement done 70 years ago Unfortunately, nothing in MSM

ObamaMSM says no reason to celebrate because you didn't build it.

11 posted on 12/01/2012 10:50:44 AM PST by presently no screen name
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith
Day One

Outstanding film about the making of the atomic bomb which restages the dramatic "Pile" sequence.

12 posted on 12/01/2012 11:06:02 AM PST by onedoug
[ Post Reply | Private Reply | To 1 | View Replies]

To: All

It’s amazing that some of these people are still alive and can share history with us.


13 posted on 12/01/2012 11:17:59 AM PST by Nowhere Man (It is about time we re-enact Normandy, at the shores of the Potomac.)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Elsiejay

I talked to a man who was in the Army on Tinian the day they loaded up the Enola Gay. He remembers watching it but it was covered up so he wasn’t sure what was going on. The plane took off and returned and he remembers serving Colonial Tibbetts in the officer;s club where Tibbetts kept going on “what we have done?” He passed away this year at the age of 90. It’s amazing to talk to someone who was there. BTW, he remembers Bocks Car too.


14 posted on 12/01/2012 11:22:07 AM PST by Nowhere Man (It is about time we re-enact Normandy, at the shores of the Potomac.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: freeagle

Suggest you read next: “The Making of the Atomic Bomb” by Richard Rhodes and “American Prometheus” by Kai Bird and Martin J. Sherwin (bigraphy of Oppenheimer). They’ll be great follow-ons!


15 posted on 12/01/2012 11:58:03 AM PST by ProtectOurFreedom
[ Post Reply | Private Reply | To 6 | View Replies]

To: ProtectOurFreedom
“The Making of the Atomic Bomb” by Richard Rhodes

Truly one of the most outstanding works of non-fiction of the past 25 years. The first paragraph of the first chapter sets the tone of this compelling book:


16 posted on 12/01/2012 12:17:43 PM PST by billorites (freepo ergo sum)
[ Post Reply | Private Reply | To 15 | View Replies]

To: AdmSmith; 6SJ7; AFPhys; Arkinsaw; allmost; aristotleman; autumnraine; Beowulf; Bones75; BroJoeK; ...

Thanks AdmSmith!


· List topics · post a topic · subscribe · Google ·

17 posted on 12/01/2012 12:44:33 PM PST by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: Zakeet
fermi and others were worried a giant black hole might occur..

prophetic they were.. or ?

18 posted on 12/01/2012 12:56:22 PM PST by NormsRevenge (Semper Fi)
[ Post Reply | Private Reply | To 5 | View Replies]

To: AdmSmith
At the Trinity test, Fermi offered bets as to whether the bomb would ignite the atmosphere and if it would destroy the world or just New Mexico.

He was a real card. :)

19 posted on 12/01/2012 1:00:48 PM PST by TonyInOhio
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

Some years back I was on a project at the U of Chicago.

I recalled a sculpture that marks the spot and ask Dave (my boss) if we were near the original site.

Dave about choked! Then said, safety had reviewed the area? The tunnels are like a maze and people often get lost. The tunnels are semi public and should have been safe but if safety or OSHA were to visit I would have had some explaining to do.


20 posted on 12/01/2012 5:15:03 PM PST by DUMBGRUNT (The best is the enemy of the good!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ProtectOurFreedom

Thank you! Shall do.

I received a college prep education, achieved multiple college degrees, but other than hearing about these scientists in passing, wasn’t encouraged to read or learn about them and their achievements. I had aptitude for science and math too ((not enough to pursue careers in them, but plenty to appreciate and understand).

:)


21 posted on 12/01/2012 8:30:04 PM PST by freeagle
[ Post Reply | Private Reply | To 15 | View Replies]

To: freeagle

I’m a Mechanical Engineer and learned about the pantheon of famous scientists in my physics classes — but almost wholly by name or by a named physical constant. We never thought about them as men and their life-long quests to understand the world around us. These books opened up a whole new perspective for me. Enjoy!


22 posted on 12/01/2012 10:06:24 PM PST by ProtectOurFreedom
[ Post Reply | Private Reply | To 21 | View Replies]

To: billorites
It grabs you right there, doesn't it?

The anecdote concerns Szilard's flash of insight concerning the recently observed naturally occurring fission of uranium, with neutrons (themselved only recently identified) as byproducts.

A single atom splitting released an incredible amount of energy for its mass. It was estimated that a single proton's mass, if completely converted into energy according to Einstein's famous equation, would release enough energy to make a very small mass such as a pollen grain jump enough to be visible under an ordinary microscope.

But a neutron, he realized, could easily wander into another nucleus and cause it to split. And if a typical split released two or more neutrons (the number was not yet known), a chain reaction could occur. And if this reaction was rapid, as Szilard had every reason to think it would be, an unprecedentedly energetic explosion might result. In other words, an "atomic bomb."

I also recommend Rhodes' Dark Sun, which carries the story forward into the thermonuclear era, and tells the story of the parallel Soviet effort, for which he gained access to former Soviet archives and surviving scientists.

23 posted on 12/01/2012 10:51:59 PM PST by Erasmus (Zwischen des Teufels und des tiefen, blauen Meers)
[ Post Reply | Private Reply | To 16 | View Replies]

To: Erasmus
"It grabs you right there, doesn't it?"

It certainly grabbed me. That opening paragraph has stuck in my mind for close to twenty years since I first read the book.

Dark Sun gets delivered by Amazon on Weds.

with free shipping.

and no sales tax.

What a country!

24 posted on 12/02/2012 4:58:04 AM PST by billorites (freepo ergo sum)
[ Post Reply | Private Reply | To 23 | View Replies]

To: Erasmus; DUMBGRUNT; onedoug; SunkenCiv; Fresh Wind; freeagle; brivette; gorush

If we talk about the father of nuclear fission, we have to make it the mother of nuclear fission. http://en.wikipedia.org/wiki/Ida_Noddack was the first to articulate the idea in 1934: “it is conceivable that the nucleus breaks up into several large fragments, which would of course be isotopes of known elements but would not be neighbors of the irradiated element”

If we shall thank someone that http://en.wikipedia.org/wiki/Enrico_Fermi could escape from Italy it is Alfred Nobel. Thanks to the Nobel prize Fermi was able to get out of Italy with his family. And the rest is, as we say, history.

Fermi died 1954 at age 53 of stomach cancer in Chicago. I think that the reason was the sloppy safety regulations and that Fermi ingested alpha-emitters during lunch in the early days.


25 posted on 12/02/2012 10:51:09 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 23 | View Replies]

We should not do like the Nobel Prize Committee and forget http://en.wikipedia.org/wiki/Lise_Meitner , she should have received the Nobel Prize together with http://en.wikipedia.org/wiki/Otto_Hahn in 1945.


26 posted on 12/02/2012 10:58:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 25 | View Replies]

To: AdmSmith

Stagg Field, home of the squash courts which housed the Met Lab's Chicago Pile 1.

Proof that Stagg Field once hosted football.

I passed by the location of Chicago Pile 1 many times in the sixties while competing in open entry track meets held at Stagg Field. While Stagg Field was no longer used for football it was host to many track and field events every year. You never knew who you might see at these events as they were a good opportunity for high level athletes to keep their edge when nothing else was going on and retired athletes entered because they still loved the sport.

The football team had periods of greatness under legendary coach Amos Alonzo Stagg, winning Big 10 championships twice in the twenties. But that was then. In 1939 University of Chicago President Robert Maynard Hutchins disbanded the Maroons, the once powerful football team of the University of Chicago because, in his words, “The whole apparatus of football, fraternities, and fun is a means by which education is made palatable to those who have no business in it.” Universities, he feared, were in danger of becoming “high-class flophouses.”

There was nothing substantial to see as one passed through the passageway beneath the stands on the way to the athletic field. It was all concrete and steel girders, a modest bronze plaque marked the historical location.

The pile and its associated equipment had all been moved shortly after that first controlled chain reaction to another location in a forest preserve known as Argonne Forest. Many of the forest preserves ringing Chicago were named to memorialize World War I battlefields and the Americans who died there in the name of freedom. This was to have been the original location of the pile but unions created an intolerable delay in construction and, since Stagg Field was no longer crowded in the fall, the on campus space was immediately available.

Soon the activities of the Manhattan Project moved to the desert and the projects of the University of Chicago's Metallurgical Laboratory, a cover for the nuclear research, gave birth to Argonne National Laboratory at the new facilities for the Chicago pile, and later helped attract the Fermi National Accelerator Laboratory to a location twenty miles away.

Years later I had the opportunity to visit Leo Seren and his lovely wife at their suburban home in Evanston. Leo was on Enrico Fermi's team and devised ways to accurately measure the density of neutrons in the graphite, uranium and cadmium that composed the pile. He was present at the first sustained reaction under the stands that day. Never able to reconcile his contribution to the death and destruction wrought by the atomic bombs, he became an anti-nuclear proponent.

To this day I benefit from Leo's love of lemon meringue pie. His charming and gorgeous wife, Marge, was undergoing treatments for cancer. Exhausted, she needed a little help around the house and placed an ad. As a college student my future wife responded, and was hired to do cooking, cleaning, and laundry on a part time basis. The two got along very well and my wife hesitated to disappoint when asked if she could make Leo's favorite dessert. Naturally, she responded positively though she had never baked a lemon meringue pie in her life.

Fortunately, she could consult a pro. My grandmother had baked cakes, pies and cookies and made tea sandwiches to make a little extra money during tough times and had continued baking for the rest of her life. Of course she had a time tested recipe for said pie and would coach a brash student through a trial effort.

The results were superb. Marge was able to present Leo with his favorite dessert in spite of her weakened condition and Leo's grateful response was that it was the best he had ever tasted. From nuclear physics to small human pleasures. What was God thinking? Apparently He has greater plans for us than we can know. A future that requires us to persist in the face of obstacles, to keep an eye on our goals while wrestling with the mundane, and to seek a moral path amid countless distractions.

The plaque which now is attached to the base of a Henry Moore sculpture marking
the significance of the site.

Enrico Fermi

Walter Zinn oversees the placement of graphite blocks forming
the first layers that would compose the pile.

An artist's rendering of the Pile. No photos, everything was top secret. It was feared that
if the Germans discovered the status of American research they would redouble their efforts
and be the first with the bomb.

49 people were present to observe the first controled nuclear chain reaction. When the pile
became critical, a self sustaining reaction, a bottle of chianti was produced from a brown bag by
Eugene Wigner and those present toasted the occasion using paper cups. The bottle was passed
around and each person signed the chianti's basket.

A marker noting the underground resting place of Chicago Pile 1 at the original site of
Argonne National Laboritory.

27 posted on 12/02/2012 6:46:32 PM PST by concentric circles
[ Post Reply | Private Reply | To 1 | View Replies]

To: concentric circles

One hell of a post. I grew up post WWII within 20mi of Oak Ridge. That kind of secrecy is something to behold.


28 posted on 12/02/2012 6:59:19 PM PST by eyedigress ((zOld storm chaser from the west)/?)
[ Post Reply | Private Reply | To 27 | View Replies]

To: eyedigress

Its interesting that there exists a photo of Zinn showing initial construction but supposedly no other photos. Someone must have blown a gasket when they found out about someone taking shots and put an immediate stop to it, perhaps Zinn’s boss, Fermi.

As a side note, the second photo shows University of Chicago All American Jay Berwanger who would be awarded the first Heisman Trophy. He is reported to have left a scar forever visible on the face of Michigan opponent and future president Jerry Ford.


29 posted on 12/02/2012 8:04:40 PM PST by concentric circles
[ Post Reply | Private Reply | To 28 | View Replies]

To: concentric circles

As you know cameras would have been forbidden but back then few folks had them. My great neighbor took me through the old reactors in Oak Ridge. It was quite the tour.

His only advice... Don’t decide to go swimming just yet!....


30 posted on 12/02/2012 8:12:53 PM PST by eyedigress ((zOld storm chaser from the west)/?)
[ Post Reply | Private Reply | To 29 | View Replies]

To: concentric circles

BTW this plant I speak of was strictly DOD.


31 posted on 12/02/2012 8:17:41 PM PST by eyedigress ((zOld storm chaser from the west)/?)
[ Post Reply | Private Reply | To 29 | View Replies]

To: eyedigress

Clinton Laboratories after the war and prior to designation as Oak Ridge National Laboratory. The original graphite reactor was housed in the largest structure. The pile wasn't actually much larger than Chicago Pile 1 but it incorporated more extensive safety measures including an immense concrete enclosure.

32 posted on 12/02/2012 11:25:06 PM PST by concentric circles
[ Post Reply | Private Reply | To 31 | View Replies]

To: concentric circles

Thanks!


33 posted on 12/02/2012 11:45:09 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 27 | View Replies]

To: AdmSmith

Related thread: Fermi’s Anniversary: Seventy years ago, a scientific breakthrough revolutionized nuclear technology.

http://www.freerepublic.com/focus/news/2965989/posts


34 posted on 12/06/2012 11:09:46 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson