Free Republic
Browse · Search
News/Activism
Topics · Post Article

Audio from Aaron Klein's Oct. 21 radio program:

http://kleinonline.wnd.com/audio/game-changer-what-really-happened-in-benghazi-part-i/

http://kleinonline.wnd.com/audio/game-changer-what-really-happened-in-benghazi-part-ii/

1 posted on 10/24/2012 8:11:02 PM PDT by Dajjal
[ Post Reply | Private Reply | View Replies ]


To: Dajjal

two thoughts come to mind:

Play with fire, and you will get burned

Fallacy of Control


2 posted on 10/24/2012 8:13:13 PM PDT by PGR88
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Dajjal
So it was mostly a CIA operation not unlike Iran-Contra.

Still, arming the muzzie bros is not a good idea.

3 posted on 10/24/2012 8:15:19 PM PDT by Paladin2
[ Post Reply | Private Reply | To 1 | View Replies ]

To: All
Klein believes that Obama would prefer the discussion be about his competence in defending a US outpost rather than have the discussion be about him arming Islamic jihadists.
4 posted on 10/24/2012 8:15:28 PM PDT by Dajjal (Justice Robert Jackson was wrong -- the Constitution IS a suicide pact.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: All

I wonder whether the building was also used to warehouse the weapons being handed out — or, at least, whether the attackers believed that weapons were being stored there.


5 posted on 10/24/2012 8:19:03 PM PDT by Dajjal (Justice Robert Jackson was wrong -- the Constitution IS a suicide pact.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Dajjal

feeding the alligator, expecting not to be eaten

my dog and I could run the “middle east bureau” better than these ... people


7 posted on 10/24/2012 8:21:08 PM PDT by RobinOfKingston (The instinct toward liberalism is located in the part of the brain called the rectal lobe.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: narses; Pyro7480; NYer; Salvation; AdmSmith; Aquinasfan; Siobhan; Maeve; XR7; SJackson; ...

Benghazi news ping


8 posted on 10/24/2012 8:24:40 PM PDT by Dajjal (Justice Robert Jackson was wrong -- the Constitution IS a suicide pact.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Dajjal

Congress? We don’t need no stinking Congress!


9 posted on 10/24/2012 8:25:01 PM PDT by rfp1234
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Dajjal

The U.S. diplomatic mission in Benghazi, Libya, actually served as a meeting place to coordinate aid for the rebel-led insurgencies in the Middle East, according to Middle Eastern security officials.

Okay, since this appears to have been a site used to work against America’s interests, do I have to cheer for the “ambassader’s” murderers? I already have to side with Russia on the situation in Syria.


10 posted on 10/24/2012 8:25:01 PM PDT by freedomfiter2 (Brutal acts of commission and yawning acts of omission both strengthen the hand of the devil.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Dajjal

bttt


11 posted on 10/24/2012 8:25:23 PM PDT by Just mythoughts (Please help Todd Akin defeat Claire and the GOP-e send money!!!!!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Dajjal

Well then it was very stupid to have the ambassador’s office there.


12 posted on 10/24/2012 8:41:22 PM PDT by HiTech RedNeck (cat dog, cat dog, alone in the world is a little cat dog)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Dajjal

Pleased to meet you. Hope you guess my name.

But what's puzzling you is the nature of my game.

14 posted on 10/24/2012 8:48:54 PM PDT by chris37 (Heartless.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Dajjal

Well, I’lbee,, if this story is anywhere close to what happened in Benghazi, I may not feel so bad about the ambasador and his people, amd I might begin to understand why the President choose to lie and blame that movie, after all it is much the lesser of two evils, much as that blue dress and I did not have sexual relation with that woman was better for Clinton than the money laundering donation from China and Indonesia. that stupid movie might just be the blue dress with stains on it, time will tell, but likely not until after the election, no mather who winns it


17 posted on 10/24/2012 8:58:37 PM PDT by munin
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Dajjal

It is then very possible that Syrians were behind false flagging this attack.


20 posted on 10/24/2012 9:03:41 PM PDT by TomasUSMC ( FIGHT LIKE WW2, FINISH LIKE WW2. FIGHT LIKE NAM, FINISH LIKE NAM)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: LucyT

ping


21 posted on 10/24/2012 10:27:40 PM PDT by Fractal Trader
[ Post Reply | Private Reply | To 1 | View Replies ]

To: hoosiermama; penelopesire; thouworm; Protect the Bill of Rights; LucyT; SE Mom; MestaMachine; ...

More CYA ... but maybe some relevant facts. Does it seem she was assuming Stevens was kidnapped??

http://online.wsj.com/article/SB10000872396390443684104578066631931377740.html

(snip)

In the Benghazi crisis, she made a previously undisclosed call to Libyan President Mohammed Magarief seeking immediate help in finding the missing U.S. ambassador,

(snip)

Then on Sept. 11, the State Department at 4 p.m. received an alert from its Libyan embassy in Tripoli. The U.S. ambassador, Mr. Stevens, visiting the Benghazi consulate, had delivered a one-sentence message: “We’re under attack.”

At 4:20 p.m., State Department executive secretary Steve Mull alerted Mrs. Clinton in her office. According to a person present, Mrs. Clinton asked, “How are we getting more security on the ground? More communication on the ground?”

And she said: “Find Chris,” the U.S. ambassador. She had handpicked him for the posting.

At 5 p.m., Mr. Mull informed her that they couldn’t locate the ambassador or reach his cellphone. But he said the department’s “Ops Center” had an open line with the Tripoli embassy. Mrs. Clinton moved there for a video conference with White House, military and intelligence officials, who ordered increased security regionwide. Mrs. Clinton remained at the State Department until midnight.

Overnight, Mr. Stevens’ body was identified at a Benghazi hospital. Mrs. Clinton returned to the State Department at 7 the next morning to inform the world of the tragedy.

(snip)

+++++++++++++++++++++++++++++++++++++++

http://www.state.gov/r/pa/prs/appt/2012/09/197186.htm

Public Schedule for September 11, 2012

U.S. DEPARTMENT OF STATE
PUBLIC SCHEDULE
TUESDAY SEPTEMBER 11, 2012

SECRETARY HILLARY RODHAM CLINTON

9:20 a.m. Secretary Clinton meets with the Fulbright Foreign Scholarship Board, at the Department of State.
(CLOSED PRESS COVERAGE)

10:15 a.m. Secretary Clinton holds a swearing-in ceremony for U.S. Ambassador to Ghana Gene Cretz, at the Department of State.
(CLOSED PRESS COVERAGE)

12:00 p.m. Secretary Clinton meets with Secretary of Defense Leon Panetta and National Security Adviser Tom Donilon, at the White House.
(MEDIA DETERMINED BY WHITE HOUSE)

2:15 p.m. Secretary Clinton attends the Flag Ceremony for Cameron Munter, at the Department of State.
(CLOSED PRESS COVERAGE)

4:00 p.m. Secretary Clinton holds a swearing-in ceremony for U.S. Ambassador to Serbia Michael Kirby, at the Department of State.
(CLOSED PRESS COVERAGE)

http://www.whitehouse.gov/schedule/complete/2012-09-11

5:00 pm
The President and the Vice President meet with Secretary of Defense
Oval Office
Closed Press

http://articles.boston.com/2012-09-12/world/33776446_1_benghazi-revolt-against-libyan-leader-president-barack-obama

“Obama was informed about the developments in Libya by his National Security Adviser Tom Donilon as the president began a weekly meeting Secretary of Defense Leon Panetta and Chairman of the Joint Chiefs of Staff Martin Dempsey. The White House said Obama was kept apprised throughout the evening and then again Wednesday morning.”


28 posted on 10/25/2012 4:27:16 AM PDT by maggief
[ Post Reply | Private Reply | To 1 | View Replies ]

To: gandalftb

ping


39 posted on 10/25/2012 1:45:28 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson