Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

NYT: White House advisors totally surprised by Obama-Clinton press conference
Hot Air ^ | DECEMBER 10, 2010 | ALLAHPUNDIT

Posted on 12/10/2010 6:46:45 PM PST by RobinMasters

click here to read article


Navigation: use the links below to view more comments.
first previous 1-20 ... 181-200201-220221-240 ... 361 next last
To: Optimist

Agree and your last line was quite funny.


201 posted on 12/10/2010 11:24:25 PM PST by Gene Eric (Your Hope has been redistributed. Here's your Change.)
[ Post Reply | Private Reply | To 119 | View Replies]

To: Revolting cat!

Go Joe. We can laugh at him while he puts his foot in his mouth daily.


202 posted on 12/10/2010 11:26:30 PM PST by Red Steel
[ Post Reply | Private Reply | To 24 | View Replies]

To: RobinMasters


NYT: White House advisors totally surprised by Obama-Clinton press conference

When I tuned into Fox News Channel and saw Bubba in front of the
wall-hanging of “The White House”, I initially thought that I was
watching archival footage from Bubba’s two terms.

I about FREAKED when I realized that an X-President was actually giving
a press conference in The White House RIGHT THEN.

Bubba’s conference SCREAMS “Obama Ain’t Up To The Job”.
Don’t expect the MSM to say that. The MSM would surely say that if this
suprising even featured two Republicans.

I’m still waiting to hear any media outlet (including Fox News Channel)
to say if such an event has ever happened before.
(I.E., a former President giving a press conference at The White House)

Also, I initially thought maybe “Obama has fired Robert Gibbs and hired Bubba
to be The White House spokesperson!!!


203 posted on 12/10/2010 11:34:09 PM PST by VOA
[ Post Reply | Private Reply | To 1 | View Replies]

To: garbanzo
King Lear was the first thought that came to my mind.

The trouble with OBummer, he has no one who loves him more than he loves himself.

204 posted on 12/10/2010 11:55:08 PM PST by The Cajun
[ Post Reply | Private Reply | To 197 | View Replies]

To: VOA; Seizethecarp; onyx; mojitojoe; SE Mom; hoosiermama; maggief; Liz

Clinton at White House Sets Twitter on Fire

###

Excerpt:

Political Washington watched, slack-jawed, as President Obama on Friday offered former President Bill Clinton the White House briefing room and Mr. Clinton took it – for a full half-hour.

http://thecaucus.blogs.nytimes.com/2010/12/10/clinton-at-the-white-house-sets-twitter-on-fire/


205 posted on 12/10/2010 11:55:54 PM PST by STARWISE (The overlords are in place .. we are a nation under siege .. pray, go Galt & hunker down)
[ Post Reply | Private Reply | To 203 | View Replies]

To: pyx
Obama is standing there with that smirky smile on his face and his arms crossed. He is so full of himself that I really don't think he understands what has already occurred and is about to get worse. Obama literally abdicated his position to a senior politician/ex president today. He couldn't make the case himself strongly enough to his own party or the press, so he brought in Billy Jeff to do it for him. Oh, that cost Obama. That really cost him.
206 posted on 12/11/2010 12:03:58 AM PST by MWestMom (Tread carefully, truth lies here.)
[ Post Reply | Private Reply | To 151 | View Replies]

To: RobinMasters

Wife’s a bit, I mean, life’s a bit$#!


207 posted on 12/11/2010 12:06:37 AM PST by conservativeimage ("Uh, let me be clear. Uh." - President Barack Obama)
[ Post Reply | Private Reply | To 1 | View Replies]

To: celtic gal

You are correct. I was thinking of the nonconsecutive idea of of term limits. However, the 22nd amendment says there can never be more than two elected terms whether they are consecutive or not.


208 posted on 12/11/2010 12:10:30 AM PST by jonrick46 (We're being water boarded with the sewage of Fabian Socialism.)
[ Post Reply | Private Reply | To 165 | View Replies]

To: RobinMasters

Wikileaks has proof he’s a Kenyan.


209 posted on 12/11/2010 12:32:20 AM PST by naturalized
[ Post Reply | Private Reply | To 1 | View Replies]

To: STARWISE

Thank you ma’am.

this would be the best Merry Christmas America present possible


210 posted on 12/11/2010 2:00:31 AM PST by DollyCali (Don't tell God how big your storm is... tell your storm how BIG your God is!)
[ Post Reply | Private Reply | To 66 | View Replies]

To: FrankR; SunkenCiv

This is no big deal, just a way to reduce the heat from left wing Democrats outraged about the deal to extend Bush administration tax cuts.


211 posted on 12/11/2010 2:13:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Windflier

So Obama is admiting this is above his paygrade? Or it’s mission accomplished for him, on to becoming president of the UN and the world!


212 posted on 12/11/2010 3:50:51 AM PST by ronnie raygun (V)
[ Post Reply | Private Reply | To 38 | View Replies]

To: freekitty

I believe they are all working together on this succession to power, zero starts the ball rolling for a term, bill primes the pumps for hillary in 2012, zero gets what he really wants is president of the world, head of the UN. This is a global effort with the help of the chicoms, soros and a host of international socialist globalist organizations. These criminlas are despicable in thier personal lives this is easy for them.


213 posted on 12/11/2010 4:02:23 AM PST by ronnie raygun (V)
[ Post Reply | Private Reply | To 116 | View Replies]

To: MWestMom

Clinton seemed far more informed than bama on the issues.


214 posted on 12/11/2010 4:05:31 AM PST by GlockThe Vote (Who needs Al Queda to worry about when we have Obama?)
[ Post Reply | Private Reply | To 206 | View Replies]

To: Revolting cat!
First, I just don't see that happening even if Zero had a total mental meltdown.

Second, seriously, the Dems would in any way, shape, or form let CLINTON---an old man with a very bad ticker (who looks older by the minute)---come back in? Nope. And I know you said Biden, but the whole thing with Clinton is creepy.

215 posted on 12/11/2010 4:11:28 AM PST by LS ("Castles made of sand, fall in the sea . . . eventually." (Hendrix))
[ Post Reply | Private Reply | To 24 | View Replies]

To: FTJM

Obama is so weak. He is so desperate he passes the baton to an impeached POTUS.

I wonder if slick willy told him how to move to the center?
LOL there is no democratic party left to respect; so he is a one termer and they think Feingold will save them? LOL I laugh while I cry as they destroy America.


216 posted on 12/11/2010 4:27:03 AM PST by Dubya-M-DeesWent2SyriaStupid!
[ Post Reply | Private Reply | To 20 | View Replies]

To: diverteach

Me too. It is weird.


217 posted on 12/11/2010 4:30:14 AM PST by Dubya-M-DeesWent2SyriaStupid!
[ Post Reply | Private Reply | To 15 | View Replies]

To: Lancey Howard; Windflier
Ubama was slipping out for a couple of lines and a smoke, guaranteed.

I want to know what he and B were snorting just before the presser. Seriously. I think they both seem high.

218 posted on 12/11/2010 4:45:04 AM PST by b9 (P rinciple A uthenticity L eadership I ntegrity N ational pride)
[ Post Reply | Private Reply | To 124 | View Replies]

To: RobinMasters

Bull dookie.

LLS


219 posted on 12/11/2010 4:47:40 AM PST by LibLieSlayer (WOLVERINES!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: E. Pluribus Unum
He`s leaving to become the head of the UN, this has apparently been the plan all along.

He can say he would run for a 2nd term but he has been asked to take a higher office where he can make a bigger mess of things

220 posted on 12/11/2010 4:54:26 AM PST by Friendofgeorge (SARAH 2012 OR BUST)
[ Post Reply | Private Reply | To 6 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 181-200201-220221-240 ... 361 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson