Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

NYT: White House advisors totally surprised by Obama-Clinton press conference
Hot Air ^ | DECEMBER 10, 2010 | ALLAHPUNDIT

Posted on 12/10/2010 6:46:45 PM PST by RobinMasters

Oh, I’ll bet they were. Say what you will about Axe, Gibbsy, and the rest of the crew, but I’d like to think they have the basic political common sense to avoid photo ops where the president has to skip out after a minute or two to go eat gingerbread cookies.

I’d like to think The One had the same basic political common sense, but … we learn something new every day, don’t we?

The leader of the free world and the ex-leader wandered a deserted hallway, past the offices of the senior advisers, only to discover the door to the press corps briefing room locked.

(Excerpt) Read more at hotair.com ...


TOPICS: Constitution/Conservatism; Culture/Society; Front Page News; News/Current Events; Politics/Elections
KEYWORDS: baghdadbobgibbs; bombandbomber; clinton; failedpresidency; handoff; obama; savingobama; savingpvtobama; wikileaks
Navigation: use the links below to view more comments.
first previous 1-50 ... 151-200201-250251-300 ... 351-361 next last
To: Optimist

Agree and your last line was quite funny.


201 posted on 12/10/2010 11:24:25 PM PST by Gene Eric (Your Hope has been redistributed. Here's your Change.)
[ Post Reply | Private Reply | To 119 | View Replies]

To: Revolting cat!

Go Joe. We can laugh at him while he puts his foot in his mouth daily.


202 posted on 12/10/2010 11:26:30 PM PST by Red Steel
[ Post Reply | Private Reply | To 24 | View Replies]

To: RobinMasters


NYT: White House advisors totally surprised by Obama-Clinton press conference

When I tuned into Fox News Channel and saw Bubba in front of the
wall-hanging of “The White House”, I initially thought that I was
watching archival footage from Bubba’s two terms.

I about FREAKED when I realized that an X-President was actually giving
a press conference in The White House RIGHT THEN.

Bubba’s conference SCREAMS “Obama Ain’t Up To The Job”.
Don’t expect the MSM to say that. The MSM would surely say that if this
suprising even featured two Republicans.

I’m still waiting to hear any media outlet (including Fox News Channel)
to say if such an event has ever happened before.
(I.E., a former President giving a press conference at The White House)

Also, I initially thought maybe “Obama has fired Robert Gibbs and hired Bubba
to be The White House spokesperson!!!


203 posted on 12/10/2010 11:34:09 PM PST by VOA
[ Post Reply | Private Reply | To 1 | View Replies]

To: garbanzo
King Lear was the first thought that came to my mind.

The trouble with OBummer, he has no one who loves him more than he loves himself.

204 posted on 12/10/2010 11:55:08 PM PST by The Cajun
[ Post Reply | Private Reply | To 197 | View Replies]

To: VOA; Seizethecarp; onyx; mojitojoe; SE Mom; hoosiermama; maggief; Liz

Clinton at White House Sets Twitter on Fire

###

Excerpt:

Political Washington watched, slack-jawed, as President Obama on Friday offered former President Bill Clinton the White House briefing room and Mr. Clinton took it – for a full half-hour.

http://thecaucus.blogs.nytimes.com/2010/12/10/clinton-at-the-white-house-sets-twitter-on-fire/


205 posted on 12/10/2010 11:55:54 PM PST by STARWISE (The overlords are in place .. we are a nation under siege .. pray, go Galt & hunker down)
[ Post Reply | Private Reply | To 203 | View Replies]

To: pyx
Obama is standing there with that smirky smile on his face and his arms crossed. He is so full of himself that I really don't think he understands what has already occurred and is about to get worse. Obama literally abdicated his position to a senior politician/ex president today. He couldn't make the case himself strongly enough to his own party or the press, so he brought in Billy Jeff to do it for him. Oh, that cost Obama. That really cost him.
206 posted on 12/11/2010 12:03:58 AM PST by MWestMom (Tread carefully, truth lies here.)
[ Post Reply | Private Reply | To 151 | View Replies]

To: RobinMasters

Wife’s a bit, I mean, life’s a bit$#!


207 posted on 12/11/2010 12:06:37 AM PST by conservativeimage.com ("Uh, let me be clear. Uh." - President Barack Obama)
[ Post Reply | Private Reply | To 1 | View Replies]

To: celtic gal

You are correct. I was thinking of the nonconsecutive idea of of term limits. However, the 22nd amendment says there can never be more than two elected terms whether they are consecutive or not.


208 posted on 12/11/2010 12:10:30 AM PST by jonrick46 (We're being water boarded with the sewage of Fabian Socialism.)
[ Post Reply | Private Reply | To 165 | View Replies]

To: RobinMasters

Wikileaks has proof he’s a Kenyan.


209 posted on 12/11/2010 12:32:20 AM PST by naturalized
[ Post Reply | Private Reply | To 1 | View Replies]

To: STARWISE

Thank you ma’am.

this would be the best Merry Christmas America present possible


210 posted on 12/11/2010 2:00:31 AM PST by DollyCali (Don't tell God how big your storm is... tell your storm how BIG your God is!)
[ Post Reply | Private Reply | To 66 | View Replies]

To: FrankR; SunkenCiv

This is no big deal, just a way to reduce the heat from left wing Democrats outraged about the deal to extend Bush administration tax cuts.


211 posted on 12/11/2010 2:13:11 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Windflier

So Obama is admiting this is above his paygrade? Or it’s mission accomplished for him, on to becoming president of the UN and the world!


212 posted on 12/11/2010 3:50:51 AM PST by ronnie raygun (V)
[ Post Reply | Private Reply | To 38 | View Replies]

To: freekitty

I believe they are all working together on this succession to power, zero starts the ball rolling for a term, bill primes the pumps for hillary in 2012, zero gets what he really wants is president of the world, head of the UN. This is a global effort with the help of the chicoms, soros and a host of international socialist globalist organizations. These criminlas are despicable in thier personal lives this is easy for them.


213 posted on 12/11/2010 4:02:23 AM PST by ronnie raygun (V)
[ Post Reply | Private Reply | To 116 | View Replies]

To: MWestMom

Clinton seemed far more informed than bama on the issues.


214 posted on 12/11/2010 4:05:31 AM PST by GlockThe Vote (Who needs Al Queda to worry about when we have Obama?)
[ Post Reply | Private Reply | To 206 | View Replies]

To: Revolting cat!
First, I just don't see that happening even if Zero had a total mental meltdown.

Second, seriously, the Dems would in any way, shape, or form let CLINTON---an old man with a very bad ticker (who looks older by the minute)---come back in? Nope. And I know you said Biden, but the whole thing with Clinton is creepy.

215 posted on 12/11/2010 4:11:28 AM PST by LS ("Castles made of sand, fall in the sea . . . eventually." (Hendrix))
[ Post Reply | Private Reply | To 24 | View Replies]

To: FTJM

Obama is so weak. He is so desperate he passes the baton to an impeached POTUS.

I wonder if slick willy told him how to move to the center?
LOL there is no democratic party left to respect; so he is a one termer and they think Feingold will save them? LOL I laugh while I cry as they destroy America.


216 posted on 12/11/2010 4:27:03 AM PST by Dubya-M-DeesWent2SyriaStupid!
[ Post Reply | Private Reply | To 20 | View Replies]

To: diverteach

Me too. It is weird.


217 posted on 12/11/2010 4:30:14 AM PST by Dubya-M-DeesWent2SyriaStupid!
[ Post Reply | Private Reply | To 15 | View Replies]

To: Lancey Howard; Windflier
Ubama was slipping out for a couple of lines and a smoke, guaranteed.

I want to know what he and B were snorting just before the presser. Seriously. I think they both seem high.

218 posted on 12/11/2010 4:45:04 AM PST by b9 (P rinciple A uthenticity L eadership I ntegrity N ational pride)
[ Post Reply | Private Reply | To 124 | View Replies]

To: RobinMasters

Bull dookie.

LLS


219 posted on 12/11/2010 4:47:40 AM PST by LibLieSlayer (WOLVERINES!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: E. Pluribus Unum
He`s leaving to become the head of the UN, this has apparently been the plan all along.

He can say he would run for a 2nd term but he has been asked to take a higher office where he can make a bigger mess of things

220 posted on 12/11/2010 4:54:26 AM PST by Friendofgeorge (SARAH 2012 OR BUST)
[ Post Reply | Private Reply | To 6 | View Replies]

To: STARWISE

Watch the video Obama is clueless but he gives Clinton that anti christ evil look AND slick willy does cue him to stay (Obama wanted to just high tail it out and is forced to stay.)

http://www.youtube.com/watch?v=6Ac9uDLUdSs

Even the MSM seems to be seeing what a train wreck Obama is

http://bltwy.msnbc.msn.com/politics/wait-is-bill-clinton-still-president-most-awkward-parts-of-obama-press-conference-9188.gallery?photoId=35788


221 posted on 12/11/2010 4:56:40 AM PST by Dubya-M-DeesWent2SyriaStupid!
[ Post Reply | Private Reply | To 118 | View Replies]

To: Friendofgeorge

Slide it to 10:30 Obama crosses his arms (body language)
he is closed to what slick is saying and is nervous.

http://www.youtube.com/watch?v=6Ac9uDLUdSs


222 posted on 12/11/2010 5:00:26 AM PST by Dubya-M-DeesWent2SyriaStupid!
[ Post Reply | Private Reply | To 220 | View Replies]

To: Wild Irish Rogue
...decompensating.

OMGosh! That's a great word to describe zer0's behavior:

"Psychology  The inability to maintain defense mechanisms in response to stress, resulting in personality disturbance or psychological imbalance." -- The Free Dictionary

223 posted on 12/11/2010 5:16:26 AM PST by TheOldLady ("Face it, Obama: You, too, were a useful idiot." - Lazamataz, who would hit it...with a brick.)
[ Post Reply | Private Reply | To 52 | View Replies]

To: Red Steel

And to think his other option offered by O was Sec State. Thanks that he “didn’t like to travel”. What a way to run a railroad!


224 posted on 12/11/2010 5:17:57 AM PST by InvisibleChurch (Stimulus ~ Response / "...and that's why the color yellow makes me sad, I think.")
[ Post Reply | Private Reply | To 202 | View Replies]

To: TheOldLady

Obama picked up a rattlesnake, and it bit him.


225 posted on 12/11/2010 5:20:24 AM PST by wetgundog (" Extremism in the Defense of Liberty is no Vice")
[ Post Reply | Private Reply | To 223 | View Replies]

To: FlyingEagle

I think O has fallen in love with Wallis Simpson and wants to spend the rest of their days together in quiet, contemplative seclusion.


226 posted on 12/11/2010 5:30:44 AM PST by InvisibleChurch (Stimulus ~ Response / "...and that's why the color yellow makes me sad, I think.")
[ Post Reply | Private Reply | To 31 | View Replies]

To: bannie
Hillabeast looks clean in this picture. Check out Slick’s coke nose. heheheheh
227 posted on 12/11/2010 5:36:43 AM PST by angcat (DEAR GOD PLEASE SAVE OUR COUNTRY!)
[ Post Reply | Private Reply | To 179 | View Replies]

To: Revolting cat!

Hi Cat,text him and say we have one more question:)


228 posted on 12/11/2010 5:37:18 AM PST by fatima (Free Hugs Today :))
[ Post Reply | Private Reply | To 24 | View Replies]

To: rockrr; FlyingEagle

“Yes, we are announcing that BHO is stepping down, but no - you don’t get Bubba. You get slo-jo Bidet instead.”


The thought that went through my mind was that the “Ultimate” in democrat dirty tricks at this moment would be for Obama to step down and Biden to announce that he had an incurable illness and that Pelosi was to become president and Reid would become her vice president.

Truly a terrifying thought. Let’s just hope that scenario never occurs.


229 posted on 12/11/2010 5:37:58 AM PST by The Working Man
[ Post Reply | Private Reply | To 39 | View Replies]

To: SnuffaBolshevik

For whom? Clinton?


230 posted on 12/11/2010 5:49:59 AM PST by FrdmLvr (Death to tyrants)
[ Post Reply | Private Reply | To 7 | View Replies]

To: SnuffaBolshevik

When 0bama introduced Clinton he said Bubba would be speaking BRIEFLY. I forget the exact words but some form of brief was used.
So nobody can tell us this was a planned thing, never mind a master stroke.
And a few minutes in, Clinton gave him the brush-off. 0bama tried to break in and 42 went for the touchdown.
Ate the Kenyan’s lunch and stole his ice cream too, right there on national television.
Palin’s campaign commercials practically write themselves.


231 posted on 12/11/2010 5:52:14 AM PST by 668 - Neighbor of the Beast (Grammar police off-duty. But I saw what you did.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: E. Pluribus Unum

You are correct. I have always though he wouldn’t finish his first term. He has never had a job he didn’t quit in about two to three years.


232 posted on 12/11/2010 5:54:29 AM PST by svcw
[ Post Reply | Private Reply | To 6 | View Replies]

To: Inyo-Mono

Has it been disclosed just exactly what Obama and Clinton talked about in their meeting before the presser? There was a lot of secrecy about it. Rather than Clinton being there to advise Obama, was he perhaps SENT to deliver an ultimatum? His actions would seem to reinforce that, and it could explain why Obama acted the way he did, he already knew he was toast.


233 posted on 12/11/2010 5:56:32 AM PST by smalltownslick
[ Post Reply | Private Reply | To 27 | View Replies]

To: RobinMasters

When 0bama introduced Clinton he said Bubba would be speaking BRIEFLY.
In other words 0bama was looking for brief and he went in there a boxer. A big dawg of a boxer who immediately took over and it showed. Skinny kid went into meant-to-do-that mode and left with his bloody nose in the air.


234 posted on 12/11/2010 5:59:24 AM PST by 668 - Neighbor of the Beast (Grammar police off-duty. But I saw what you did.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: smalltownslick

Good question. Supposedly, it was about the tax “deal” but it was supposed to be only a brief meeting, to get Clinton to announce his support for it, and Obama had nothing else on his official WH calendar for the day. To make it stranger, the press conference itself seems to have been purely impromptu, and Bambi’s sudden realization that he had a party (!) to go to also doesn’t seem to have been pre-planned.

I’ve been thinking about this all night because it is truly the strangest thing I’ve seen in my many decades of watching politics in this country. If nothing else, it definitely gives one the unnerving feeling that things are falling apart and spinning out of control and anything could happen now.

Obama could declare himself Master of the Universe and seize special powers, or Obama could simply pack it all in and announce that he’s found the US too constraining and now he’s going off to be head of the UN or of the Olympic Committee or who knows what, or Obama could just be carried out of the WH in a straight jacket after holding the Wookie hostage for a few hours and begging to speak to Hugo Chavez.

That said, I doubt that Bill will end up president again or that Hillary will get the job, even temporarily, but I am sure there are some wild and crazy things going on at Dem central right about now.


235 posted on 12/11/2010 6:05:09 AM PST by livius
[ Post Reply | Private Reply | To 233 | View Replies]

To: RobinMasters

“I am in charge.”


236 posted on 12/11/2010 6:07:07 AM PST by Diogenesis ('Freedom is the light of all sentient beings.' - Optimus Prime)
[ Post Reply | Private Reply | To 1 | View Replies]

To: matt1234; Revolting cat!
That most definitely deserves its own thread.

With a staple in its navel. #24 = Most alluring post I've seen in many moons.

237 posted on 12/11/2010 6:10:40 AM PST by 668 - Neighbor of the Beast (Grammar police off-duty. But I saw what you did.)
[ Post Reply | Private Reply | To 30 | View Replies]

To: FTJM

I think Bill had it right when he said to Obama “please go”... yes. PLEASE GO!


238 posted on 12/11/2010 6:13:53 AM PST by mandaladon
[ Post Reply | Private Reply | To 3 | View Replies]

To: Bullish

I guess it takes 2 Democrats to do the job of 1 Republican­.


239 posted on 12/11/2010 6:21:30 AM PST by mandaladon
[ Post Reply | Private Reply | To 41 | View Replies]

To: bgill

“Excuse me while I go soak my typing fingers in acid...”

Hey. Hey. All your fingers are belong to FR. Don’t forget the baking soda.


240 posted on 12/11/2010 6:22:34 AM PST by combat_boots (The Lion of Judah coel Jmeth. Hallelujah. Gloria Patri, Filio et Spiritui Sancto.)
[ Post Reply | Private Reply | To 178 | View Replies]

To: Revolting cat!

I reserve the right to be wrong, but I think some folks in DC have been smoking some mighty fine weed, man.


241 posted on 12/11/2010 6:22:34 AM PST by savedbygrace (But God.)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Beatthedrum
He's thin and gaunt, with any luck he's sick and joins Teddy K soon.

They had to hold the presser until dusk so Bubba could safely get out of his coffin.

242 posted on 12/11/2010 6:34:28 AM PST by libstripper (uite eff)
[ Post Reply | Private Reply | To 19 | View Replies]

To: 668 - Neighbor of the Beast

Obama forgets some people can speak without a teleprompter without saying ahhhhhhhhhhhhhhhhh ummmmm LOOK! ahhhhhhhhhhh
ummmmmmmmmmmmm um ummmmmmmmmmmmmmmmmmmm


243 posted on 12/11/2010 6:37:07 AM PST by Dubya-M-DeesWent2SyriaStupid!
[ Post Reply | Private Reply | To 234 | View Replies]

To: LucyT

IIRC, The Senators who were the farthest Left in 2007-08 were 1, 2, 3, 0bama, Clinton and Biden.

You know, if 0bama becomes “unavailable” and disappears from public like some 12th imam, Biden would be acting POTUS anyway.

Timmy G & Holbrooke in the hospital for whatever.....We have a palace coup going on.


244 posted on 12/11/2010 6:38:58 AM PST by combat_boots (The Lion of Judah coel Jmeth. Hallelujah. Gloria Patri, Filio et Spiritui Sancto.)
[ Post Reply | Private Reply | To 94 | View Replies]

To: Red Steel

Weren’t there rumors of Clinton/Clinton 2012? Ole slick can be Veep I think.


245 posted on 12/11/2010 6:39:49 AM PST by Dubya-M-DeesWent2SyriaStupid!
[ Post Reply | Private Reply | To 190 | View Replies]

To: Dubya-M-DeesWent2SyriaStupid!

He can also be President for ten years. If through some shenanigans he could be appointed to serve out the last two years of Obama’s term......


246 posted on 12/11/2010 6:44:28 AM PST by smalltownslick
[ Post Reply | Private Reply | To 245 | View Replies]

To: Revolting cat!

When my stepfather worked at the DOD, I learned the insider rumor mill was not to be taken lightly. If I had a penny for every Clinton rumor I rolled my eyes out, I would be very well off.

Ping me please if you hear any more. :-)


247 posted on 12/11/2010 6:54:29 AM PST by Protect the Bill of Rights
[ Post Reply | Private Reply | To 28 | View Replies]

To: katykelly
making zero look like a fool

"This stuff is sandbox, you people. I'm this smart and I only study for an hour a day."

248 posted on 12/11/2010 6:56:02 AM PST by 668 - Neighbor of the Beast (Grammar police off-duty. But I saw what you did.)
[ Post Reply | Private Reply | To 63 | View Replies]

To: RummyChick

"Oh, boy! Just like old times. Now if I could just figger out how to get this boy to get me coffee..."

249 posted on 12/11/2010 6:56:24 AM PST by raybbr (Someone who invades another country is NOT an immigrant - illegal or otherwise.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Dubya-M-DeesWent2SyriaStupid!

"Man, even a girl in a blue dress can't get me this excited..."

250 posted on 12/11/2010 7:04:32 AM PST by raybbr (Someone who invades another country is NOT an immigrant - illegal or otherwise.)
[ Post Reply | Private Reply | To 221 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-50 ... 151-200201-250251-300 ... 351-361 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson