Navigation: use the links below to view more comments.
first previous 1-20, 21-31 last
To: Red Badger
The highest percent of Denisovan DNA found today is in a Negrita group in the Phillipines.
An Indigenous People In The Philippines Have The Most Denisovan DNA
Ayta people in the Philippines, shown here, belong to a group of ethnic communities that includes one with the highest level of Denisovan ancestry in the world, a new study finds.Indigenous Ayta Magbukon people get 5 percent of their DNA from the mysterious ancient hominids
38 posted on
11/04/2021 9:46:36 AM PDT by
blam
To: Red Badger
the stone age Nancy Pelousian tribe
40 posted on
11/04/2021 9:56:16 AM PDT by
faithhopecharity
(“Politicians are not born. They’re excreted.” Marcus Tillius Cicero (106 to 43 BCE))
To: Red Badger
i always thought that Peking Man was not alone and but for the communist takeover/closing of the country would have had company...
surprised the reds haven’t done more digs on their own to prove their “superiority and/of linage”
or maybe they did and dint like it
41 posted on
11/04/2021 9:56:35 AM PDT by
Chode
(there is no fall back position, there's no rally point, there is no LZ... we're on our own. #FJB)
To: Red Badger
Offspring of Nephilim and women.
To: Red Badger
Now they should use AI to identify the putative primitive hominid that interbred with African Homo sapiens!
They’re probably doing it already!
49 posted on
11/04/2021 10:17:00 AM PDT by
Honorary Serb
(Kosovo is Serbia! Free Srpska! Abolish ICTY!)
To: Red Badger
How do they know that “dalliances” were shared? Maybe it wasn’t consensual.
50 posted on
11/04/2021 10:22:05 AM PDT by
webheart
(I thought I was helping by getting vaccinated but they say I didn’t help at all. )
To: Red Badger
The whole out of Africa thing is basically political correctness in place of science. It is somewhere between a dogmatic assumption and an unproven theory. It is possible that our ancestors came from Africa but it is also possible that they did not. It isn’t proven although evidence exists. This other thing is evidence against. But it is obligatory that the story include other theoretical ancestors.
53 posted on
11/04/2021 10:41:39 AM PDT by
webheart
(I thought I was helping by getting vaccinated but they say I didn’t help at all. )
To: Red Badger
A distant ancestor of Kamala Harris, who was screwing everybody.
54 posted on
11/04/2021 10:48:12 AM PDT by
PTBAA
To: Red Badger
There’s a ‘teenager’ gene?
58 posted on
11/04/2021 12:36:18 PM PDT by
lepton
("It is useless to attempt to reason a man out of a thing he was never reasoned into"--Jonathan Swift)
To: Red Badger
The assumption that it all started in Africa has been growing weaker and weaker for decades in light of discovers in Asia.
62 posted on
11/04/2021 9:56:34 PM PDT by
fella
("As it was before Noah so shall it be again,")
To: Red Badger; SunkenCiv; nuconvert; proxy_user
Here is a recent article about this (29OCT21) "Refining models of archaic admixture in Eurasia with ArchaicSeeker 2.0" More details + link to software and the data, i.e. anyone can check the results.
https://www.nature.com/articles/s41467-021-26503-5
64 posted on
11/14/2021 1:37:40 AM PST by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
Navigation: use the links below to view more comments.
first previous 1-20, 21-31 last
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson