Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Newly discovered hormone mimics the effects of exercise
MedicalXpress ^ | 3/3/15

Posted on 03/03/2015 4:23:51 PM PST by LibWhacker

Newly discovered hormone mimics the effects of exercise

mice Enlarge
Credit: Martha Sexton/public domain

Scientists at the USC Leonard Davis School of Gerontology have discovered a new hormone that fights the weight gain caused by a high-fat Western diet and normalizes the metabolism - effects commonly associated with exercising.

Hormones are molecules that act as the body's signals, triggering various physiological responses. The newly discovered hormone, dubbed "MOTS-c," primarily targets muscle tissue, where it restores , counteracting diet-induced and age-dependent .

"This represents a major advance in the identification of new treatments for age-related diseases such as diabetes," said Pinchas Cohen, dean of the USC Davis school and senior author of a study on the research, which will appear in Cell Metabolism on March 3.

To test the effects of MOTS-c, the team injected the hormone into mice fed a high-fat diet, which typically causes them to grow obese and develop a resistance to insulin. The injections not only suppressed both effects in mice, they also reversed age-dependent insulin-resistance, a condition that precedes diabetes.

"This discovery sheds new light on mitochondria and positions them as active regulators of metabolism," said Changhan Lee, assistant professor at USC Davis and lead author of the study.

MOTS-c is unique among hormones in that it is encoded in the DNA of mitochondria—the "powerhouses" of cells that convert food into energy. Other hormones are encoded in DNA in the nucleus.

Lee and Cohen collaborated with colleagues from the USC school as well as the David Geffen School of Medicine at UCLA and the National Institutes of Health.

While all of the experiments on MOTS-c to date have been performed on , the molecular mechanisms that make it function in mice exist in all mammals, including humans. The MOTS-c intellectual property has been licensed to a biotechnology company, and clinical trials in humans could begin within the next three years, Cohen said.


TOPICS: Health/Medicine; Science
KEYWORDS: exercise; hormone; hormones; mimics; motsc

1 posted on 03/03/2015 4:23:51 PM PST by LibWhacker
[ Post Reply | Private Reply | View Replies]

To: LibWhacker

The first person to put this hormone in a bottle with about 12% alcohol content will own the world.


2 posted on 03/03/2015 4:25:22 PM PST by skeeter
[ Post Reply | Private Reply | To 1 | View Replies]

To: LibWhacker

Sounds a lot like Jogging in a Jug


3 posted on 03/03/2015 4:26:40 PM PST by vrwconspiracist (The Tax Man cometh)
[ Post Reply | Private Reply | To 1 | View Replies]

To: LibWhacker; AdmSmith; AnonymousConservative; Berosus; bigheadfred; Bockscar; cardinal4; ColdOne; ...

Long, long lines at the stores!

Cutting all soy products (including the oil) out of the diet helps too.


4 posted on 03/03/2015 4:37:59 PM PST by SunkenCiv (What do we want? REGIME CHANGE! When do we want it? NOW!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: LibWhacker

I need that!


5 posted on 03/03/2015 4:38:18 PM PST by Beowulf9
[ Post Reply | Private Reply | To 1 | View Replies]

To: LibWhacker

*** have discovered a new hormone ***

As Benny Hill used to say, “What’s the difference between a vitamin and a hormone?”

“You can’t make a vitamin!”


6 posted on 03/03/2015 4:59:18 PM PST by Ruy Dias de Bivar
[ Post Reply | Private Reply | To 1 | View Replies]

To: Ruy Dias de Bivar
OooooooKay.

How do you make a hormone?

a) Put sand in her Vaseline. b) Don't pay her

7 posted on 03/03/2015 5:14:13 PM PST by null and void ( If race doesn't matter, why does it matter so much?)
[ Post Reply | Private Reply | To 6 | View Replies]

To: null and void

Sign her up for Obamacare.


8 posted on 03/03/2015 5:15:27 PM PST by Lurkina.n.Learnin (It's a shame nobama truly doesn't care about any of this. Our country, our future, he doesn't care)
[ Post Reply | Private Reply | To 7 | View Replies]

To: LibWhacker

All this crap is always in the next three years!


9 posted on 03/03/2015 5:18:03 PM PST by Empireoftheatom48 (God help the Republic but will he?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Lurkina.n.Learnin

*ouch* And a new answer, to boot!


10 posted on 03/03/2015 5:18:03 PM PST by null and void ( If race doesn't matter, why does it matter so much?)
[ Post Reply | Private Reply | To 8 | View Replies]

To: null and void

Ask Benny Hill! ;-D


11 posted on 03/03/2015 5:18:32 PM PST by Ruy Dias de Bivar
[ Post Reply | Private Reply | To 7 | View Replies]

Let's Git-R-Done!

Less than $2k to go!!

12 posted on 03/03/2015 5:20:49 PM PST by RedMDer (Keep Free Republic Alive with YOUR Donations!)
[ Post Reply | Private Reply | View Replies]

To: Ruy Dias de Bivar
Highlight the white space after my question...

Like so!

13 posted on 03/03/2015 5:22:32 PM PST by null and void ( If race doesn't matter, why does it matter so much?)
[ Post Reply | Private Reply | To 11 | View Replies]

To: LibWhacker
MOTS-c

They could make an apple flavor liquid out of it and call it MOTS Applejuice.

14 posted on 03/03/2015 5:24:34 PM PST by Zuben Elgenubi (NOPe to GOPe)
[ Post Reply | Private Reply | To 1 | View Replies]

To: null and void

Kick her in the knee.


15 posted on 03/03/2015 5:26:37 PM PST by Benito Cereno
[ Post Reply | Private Reply | To 7 | View Replies]

To: null and void

I’m an 82 year old woman and I got the joke.

.


16 posted on 03/03/2015 5:27:33 PM PST by Mears (To learn, who rules over you, simply find out who you are not allowed to criticize."~~Voltaire))
[ Post Reply | Private Reply | To 7 | View Replies]

To: Mears

I’m an 82 year old woman and I got the joke.

_____________

We have a new, younger, more innocent generation here at FR.


17 posted on 03/03/2015 6:10:32 PM PST by Chickensoup (Leftist totalitarian fascism is on the move.)
[ Post Reply | Private Reply | To 16 | View Replies]

To: null and void

Don’t pay her. Very old joke.


18 posted on 03/03/2015 6:57:32 PM PST by John S Mosby (Sic Semper Tyrannis)
[ Post Reply | Private Reply | To 7 | View Replies]

To: LibWhacker
Interesting

Highlights

MOTS-c is a 16-amino-acid peptide encoded in the mitochondrial genome

MOTS-c targets muscle and regulates metabolism via the folate-purine-AMPK pathway

MOTS-c mediates mitochondrial regulation of insulin and metabolic homeostasis

MOTS-c protects against age- and diet-dependent insulin resistance and obesity

Summary
Mitochondria are known to be functional organelles, but their role as a signaling unit is increasingly being appreciated. The identification of a short open reading frame (sORF) in the mitochondrial DNA (mtDNA) that encodes a signaling peptide, humanin, suggests the possible existence of additional sORFs in the mtDNA. Here we report a sORF within the mitochondrial 12S rRNA encoding a 16-amino-acid peptide named MOTS-c (mitochondrial open reading frame of the 12S rRNA-c) that regulates insulin sensitivity and metabolic homeostasis. Its primary target organ appears to be the skeletal muscle, and its cellular actions inhibit the folate cycle and its tethered de novo purine biosynthesis, leading to AMPK activation. MOTS-c treatment in mice prevented age-dependent and high-fat-diet-induced insulin resistance, as well as diet-induced obesity. These results suggest that mitochondria may actively regulate metabolic homeostasis at the cellular and organismal level via peptides encoded within their genome.





http://www.sciencedirect.com/science/article/pii/S1550413115000613

19 posted on 03/05/2015 4:34:46 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson